Skip to main content

GENERAL BIOLOGY II (BIO 12): GENERAL BIOLOGY II (BIO 12)

GENERAL BIOLOGY II (BIO 12)
GENERAL BIOLOGY II (BIO 12)
  • Show the following:

    Annotations
    Resources
  • Adjust appearance:

    Font
    Font style
    Color Scheme
    Light
    Dark
    Annotation contrast
    Low
    High
    Margins
  • Search within:
    • My Notes + Comments
    • Notifications
    • Privacy
  • Project HomeGeneral Biology 2
  • Projects
  • Learn more about Manifold

Notes

table of contents
  1. GENERAL BIOLOGY II (BIO 12)
  2. General Biology II Syllabus
    1. General Biology 2 (Biology 12) Lecture Syllabus – 2022-2023
    2. General Biology 2 (Biology 12) Laboratory Syllabus – 2022-2023
    3. GENERAL INFORMATION
    4. GRADING AND EXAM POLICIES:
    5. DISTANCE LEARNING & TECHNOLOGY
    6. The COVID-19 EMERGENCY and ON-CAMPUS RULES
    7. POTENTIAL IN-PERSON LABORATORY ACTIVITIES
  3. LAB 1.1: Meiosis
  4. LAB 1.2: Human Karyotype
  5. LABS 2.1 & 2.2: Animal Development – Sea Star & Frog and Chick & Human
  6. LAB 3.1: Genetics – Face Lab and Simple Genetics Problems
    1. The Face Lab
    2. Genetics Practice Problems – Simple Worksheet
  7. LAB 3.2: Practice Genetics Problems
    1. MORE GENETICS PROBLEMS
    2. Difficult Genetics Problems:
  8. LAB 4.1: Domains Bacteria and Archaea – the Prokaryotes
  9. LAB 4.2: Exam 1
  10. LAB 5.1: DNA Fingerprinting – Paternity Test
    1. Lab Experiment (summary)
    2. Practice Gels – Forensics
    3. Practice Gels – Paternity Testing
  11. LAB 5.2: DNA – Protein Synthesis
  12. LAB 6.1: Bacterial Transformation
  13. LABS 6.2 & 7.1: The Protista – The Protozoans and The Algae
  14. LAB 7.2: Exam 2
  15. LAB 8.1: Kingdom Fungi
  16. LAB 8.2: Nonvascular and Seedless Vascular Plants
  17. LAB 9.1: The Gymnosperms
    1. Plant Review Table
  18. LABS 9.2 & 10.1: Plant Development
  19. LAB 10.2: Exam 3
  20. LAB 11.1: Human Evolution and Adaptation
  21. LAB 11.2: Phylum Cnidaria
  22. LAB 12.1: Phylum Platyhelminthese
  23. LAB 12.2: Phylum Mollusca
  24. LAB 13.1: Phylum Annelida
  25. LAB 13.2: Phylum Arthropoda
  26. LAB 14.1: Deuterostomes, including Phylum Chordata
  27. LAB 14.2: Exam 4
  28. APPENDIX I: Biology 12 Slides
  29. APPENDIX II: Biology 11 & 12 Slides
  30. APPENDIX III: Laboratory Rules and Academic Responsibility

GENERAL BIOLOGY II (BIO 12)

Fall 2022 and Spring 2023 Course Materials and Study Guide

Current Author: Dr. Laura Broughton

Previous Authors: Ms. Lorraine Rice, Dr. Howard Balter, Dr. Chris Robinson

With contributions from: Ms. Kathleen Howard and Dr. James Fuller

Department of Biological Sciences, Bronx Community College of the City University of New York

General Biology II Syllabus

BCC Catalog Course Description: 4 credits/ 2 lect hrs / 4 lab hrs

General Biology II: Continuation of BIO 11 with emphasis on plant and animal development, Mendelian and molecular genetics, evolution, animal and plant diversity, and ecology. Prerequisite: BIO 11

BIOLOGY 12 LEARNING OUTCOMES: General Biology II fulfills general education requirements for the CUNY Pathways Flexible Common Core, specifically for the Scientific World requirement. A student will:

  • Conduct laboratory investigations according to given experimental procedure, collect and analyze resulting experimental data, and formulate valid conclusions based on the results.
  • Demonstrate an understanding of the relationship between structure and function in living organisms and relate this to their ecological niches in a laboratory setting.
  • Demonstrate an ability to formulate a hypothesis and conduct an experiment to test it: collect and analyze data and interpret results in a laboratory setting.
  • Identify basic principles, and the values of natural diversity, and apply them to problems or issues of a scientific nature.
  • Explain the basic tenets of Mendelian genetics and demonstrate an understanding of the basic techniques used in molecular genetics in both the laboratory and lecture setting and assignments.
  • Demonstrate an understanding of the forces of evolution and how they shape the development of life on Earth.
  • Apply the scientific method to a scientific inquiry.
  • Distinguish between scientific and nonscientific explanations of natural phenomena.
  • Perform calculations using biological data with integers, fractions (rational numbers), decimals, ratios and percentages (e.g., Hardy Weinberg theorem).
  • Generate and apply conclusions based on pattern recognition (e.g., patterns of genetic inheritance).
  • Locate, evaluate, and apply information from a variety of resources into laboratory assignments and answers to short essay questions to relate biology to everyday life situations and public concerns.
  • Demonstrate an understanding of how industrialization and biotechnology have impacted global ecology and human health in lab and lecture assignments.

CLASS SCHEDULE: You are expected to complete the required work for the class in which you are enrolled. Any holidays or unusual class days (for example holding Monday classes on a Thursday) are listed on the BCC Academic Calendar. Changes due to weather or other emergencies will be communicated through the BCC homepage, BCC email Broadcasts, and the CUNY Alert system, when appropriate.

REGISTRATION: Check your computer printout carefully. Be certain that you are registered for this section of BIO 12. You MUST be officially registered to continue attending this class. Instructors are not authorized to issue notes to permit your enrollment. It is the policy of the Department of Biological Sciences we do not over-tally for Biology 12. DO NOT attempt to register for a full section through the Biology Department or the Registrar.

General Biology 2 (Biology 12) Lecture Syllabus – 2022-2023

Required Lecture and Lab Text: Biology 2e by Mary Ann Clark, Matthew Douglas, Jung Choi, second edition, published by OpenStax, Print ISBN 1947172514, Digital ISBN 1947172522, www.openstax.org/details/books/biology-2e

Week

Lecture Topic

Lecture Reading

1.1

Characteristics of life; hierarchy of living things

All Bio 11 chapters

1.2

Meiosis

(Chapter 10.1, 10.2, 10.5) Chapter 11

2.1

Animal Development

Chapter 27.1

Chapter 43.1-43.2, 43.5-43.7

2.2

Human Development

Chapter 43.1-43.2, 43.5-43.7

3.1

Mendel’s Laws

Chapter 12

3.2

Variations on Mendel’s Laws

Chapter 12

4.1

Chromosomal Inheritance

Chapter 12, Chapter 13

4.2

Lecture Examination 1

5.1

DNA, RNA, DNA Replication

Chapter 14

5.2

Protein Synthesis

Chapter 15

6.1

Gene Regulation

Chapter 16

6.2

Biotechnology

Chapter 17

7.1

Lecture Examination 2

7.2

Evidence for Evolution

Chapter 18.1

8.1

Population Genetics

Chapter 19

8.2

Speciation

Chapter 18

9.1

Macroevolution: Phylogenies

Chapter 20, Appendix B

9.2

Macroevolution: Evolution of Taxa

Appendix B, Chapter 44.5, 22.2, 23.1, 26.1, 27.4, 47.1

10.1

The Origin of Life

21.1

10.2

Primate & Human Evolution

Chapter 29.7

11.1

Lecture Examination 3

11.2

Ecology & the Biosphere

Chapter 44

12.1

Climate Change

Chapter 44.5

12.2

Population Ecology

Chapter 45.1 – 45.5

13.1

Community Ecology

Chapter 45.6

13.2

Behavioral Ecology

Chapter 45.7

14.1

Ecosystem Ecology

Chapter 46

14.2

Conservation Biology and Biodiversity

Chapter 47

15

Lecture Final Examination

General Biology 2 (Biology 12) Laboratory Syllabus – 2022-2023

Required Lecture and Lab Text: Biology 2e by Mary Ann Clark, Matthew Douglas, Jung Choi, second edition, published by OpenStax, Print ISBN 1947172514, Digital ISBN 1947172522, www.openstax.org/details/books/biology-2e

Optional Lab Notebook: Student Lab Notebook: 70 to 100 carbonless duplicate sets, bound, by Hayden-McNeil Publishers, or similar DO NOT BUY THIS UNLESS YOU HAVE AN IN-PERSON LAB AND YOUR INSTRUCTOR INDICATES IT’S REQUIRED.

Visual Lab Supplement (in 4 parts): available as a download from https://sites.google.com/site/bio1112atbcc/bio-12-visual-lab-supplements

Please note: Laboratory activities (including the Labster simulations suggested below and the in-person activities detailed later in this Course Materials and Study Guide) are determined by your individual laboratory instructor. Your instructor will explain what activities you are required to complete in order to learn each lab topic in the syllabus below.

Week

Lab Topic & In-Person Lab Activity

Lab Reading

Online Only Lab Activities (Labster)

1.1

Meiosis

(Chapter 10.1, 10.2, 10.5) Chapter 11

Meiosis

Optional: Cell Division Principles

1.2

Human Karyotype

Chapter 10.1, Chapter 13

Optional Cytogenetics

2.1

Animal Development I

Chapter 43.1-43.2, 43.5-43.7

Embryology

2.2

Animal Development II

Chapter 43.1-43.2, 43.5-43.7

Optional: Experimental Design or The Scientific Method

3.1

Genetics I

Chapter 12

Mendelian Inheritance

3.2

Genetics II

Chapter 12

Animal Genetics

Optional: Monogenic Disorders

4.1

Prokaryotes

Chapter 22

Bacterial Cell Structure

Aseptic Technique

4.2

Lab Examination 1

Optional: Bacterial Isolation

5.1

Molecular Biology: DNA Fingerprinting

Chapter 14.1, Chapter 17.1

Pipetting: Master the Technique or Pipetting: Selecting & Using Micropipettes

5.2

Protein Synthesis

Chapter 15

Protein Synthesis

6.1

Biotechnology: Bacterial Transformation

Chapter 14.1, Chapter 17.1

Genetic Transfer in Bacteria

6.2

Protists I

Chapter 23

Molecular Cloning, Polymerase Chain Rxn, Optional: Gel Electrophoresis

7.1

Protists II

Chapter 23

Eutrophication

7.2

Lab Examination 2

8.1

Fungi

Chapter 24

Evolution: Founding Theories & Principles

8.2

Plants: Nonvascular & Seedless Vascular

Chapter 25

9.1

Plants: Gymnosperms

Chapter 26

9.2

Plants: Angiosperms

Chapter 26

10.1

Plant Reproduction & Development

Chapter 32

Biodiversity or Spatial Ecology

10.2

Lab Examination 3

11.1

Human Evolution & Adaptation

Chapter 29.7

Evolution: Are You Related to a Sea Monster

11.2

Cnidarians

Chapter 27,

Chapter 28.1 - 28.2

Biomes

12.1

Platyhelminthes

Chapter 28.3

Behavioral Thermoregulation or Foraging

12.2

Mollusca

Chapter 28.4

Population growth

Optional: Ecological Niches

13.1

Annelida

Chapter 28.4

Competition

13.2

Arthropoda

Chapter 28.6

Ecosystem Dynamics Trophic Levels

The Carbon Cycle

14.1

Deuterostomes

Chapter 28.7,

Chapter 29.1 – 29.6

Optional: Landscape Ecology

14.2

Lab Examination 4

GENERAL INFORMATION

WORKLOAD AND RESPONSIBILITIES: Students should be aware of the challenge that this course will place upon their time and effort. This is particularly true for those who lack previous educational background in the sciences, and more specifically in the biological sciences. Your success will be dependent upon your willingness to commit yourself to the necessary effort and to make use of the tools available to you. These tools include lecture and laboratory outlines and reading assignments, and laboratory exercises.

ADDITIONAL LEARNING RESOURCES:

  • Your professor may provide additional resources through Blackboard.
  • The department study lab on the fourth floor of Meister Hall (ME418) is currently CLOSED due to the COVID-19 pandemic. If circumstances significantly improve during the semester, the department study lab may re-open.
  • There is a companion website to this guide with links to relevant animations and videos: https://sites.google.com/site/bio1112atbcc/
  • The BCC library has a dedicated page for the biological sciences with study aids, enrichment materials, and multimedia resources. They also have lists of COVID-19 resources and online services that they offer.
  • The free human anatomy browser allows you to explore and study human anatomy by just signing up and logging into BioDigital Human at https://www.biodigital.com/
  • The Department of Biological Sciences phone number is (718) 289-5512.

ATTENDANCE POLICIES:

Attendance Records: To obtain a passing grade, it is necessary and important that students participate in class and complete the required work. It is your responsibility to keep track of the required work and to be aware of the calendar of class meetings for your section. The Department of Biological Sciences currently requires your instructor to take and file attendance records for every class; if you are unclear how the instructor is counting attendance for your online class, ask your instructor to clarify the requirements. Please discuss any problems with your professor privately after class. If you have different professors for laboratory and lecture, BOTH PROFESSORS must take attendance.

Absences: Excused absences are at the discretion of the professor. Instructors also have the right to mark students absent in an online class if they do not complete classwork in a timely manner. 

W, WN, and WU Grades: If a student does not attend ANY sessions of the class or complete any required work during the first three weeks, the student will be marked as NEVER ATTENDED (WN) and removed from the class roster. The student CANNOT return to class once this has occurred. If a student stops attending class and completing required work, the student will be assigned an F at midterms and a WU at the end of the semester when final grades are submitted. Students may withdraw between the third week and the last class day of the semester. Students must fill out an online withdrawl form and submit the form online in order to be assigned a grade of W. Please note, the student DOES NOT need approval from the professor to withdraw.

Excessive Absences: The Department defines an excessive absence record as unexcused absences of more than 20% of scheduled class time. Students with an excessive absence record will receive an automatic grade of F in the course. Total scheduled class time includes lab, lecture, and online attendance, as required by the particular course.  Instructors are not required to grade tests and other forms of assessment of students with an excessive absence record. Instructors are also not required to offer makeup exams for students absent from scheduled exams.

GRADING AND EXAM POLICIES:

  1. There is no extra credit given in Biology 11 or 12 in lecture or lab. You must have a passing grade on examinations and required assignments.
  2. In-person lecture sections will have 3 exams plus a final exam, while in-person lab sections will have 4 exams and no final exam.
  3. For online and hybrid sections, the number of exams and assignments is at the discretion of the instructor; however, all content on the syllabus will be assessed through either exams or assignments.
  4. The final exam in lecture will be cumulative.  That means you will be tested on the material from the first to the last class and you are responsible for everything in the lecture syllabus on the final examination.
  5. It is the policy of the Biology 11 and 12 professors that exam grades will never be dropped.
  6. The student’s final grade in Biology 12 is an average of their laboratory and lecture grades (50% for each).
    1. Lecture (50% of total)
      1. formative lecture grades like quizzes, Dbs, wikis, etc. (0 to 6% of total)
      2. Lecture Exam 1 (8 to 10% of total)
      3. Lecture Exam 2 (8 to 10% of total)
      4. Lecture Exam 3 (8 to 10% of total)
      5. Lecture Final Exam (20% of total)
    2. Laboratory (50% of total)
      1. formative lab grades like quizzes, Labster, lab notebooks, etc. (10% of total)
      2. Lab Exam 1 (10% of total)
      3. Lab Exam 2 (10% of total)
      4. Lab Exam 2 (10% of total)
      5. Lab Exam 2 (10% of total)

Academic Integrity Policy: Academic Dishonesty is prohibited in The City University of New York. Penalties for academic dishonesty include academic sanctions, such as failing or otherwise reduced grades, and/or disciplinary sanctions, including suspension or expulsion. See the following website for a description of the CUNY academic dishonesty policy: https://www.cuny.edu/about/administration/offices/legal-affairs/policies-procedures/academic-integrity-policy/ Unless you are informed otherwise by your instructor, exams taken in an online or face-to-face environment are closed book; this means you should not be accessing information from any source (textbook, website, notes, other individuals, etc.) while taking the exam. Your instructor will inform you if a quiz or exam is intended to be open book and what types of behavior are permissible. For assignments and laboratory reports, your professor will tell you when sources must be cited, when individual (your own) work is required, and when group work is acceptable. If you are unsure about the expectations for an assignment, ask your professor for clarification.

Accommodations/Disabilities: Bronx Community College respects and welcomes students of all backgrounds and abilities. In the event you encounter any barrier(s) to full participation in this course due to the impact of a disability, please contact the disAbility Services Office as soon as possible this semester. A disAbility Services specialist will meet with you to discuss the barriers you are experiencing and explain the eligibility process for establishing academic accommodations for this course. You can reach disAbility Services by email at disabilityservices@bcc.cuny.edu and phone at (718) 288-5874. You may also reach disability Services through Microsoft Teams: log in using your CUNYfirst login and join Disability Service – Student Center. 

DISTANCE LEARNING & TECHNOLOGY

Distance-Learning: If this section is listed as a fully online or hybrid course, then at least 50% of the course content will be taught online. You cannot pass this class if you do not complete all of the assigned work. To participate in this course, you must have active BCC E-mail and Blackboard accounts (which is accessible through CUNYfirst) and access to a computer and the internet. Your instructor may choose to use either the asynchronous or the synchronous online learning mode; however, your instructor should make clear what activities you are expected to complete each week and how those activities will affect your grade. All instructors should cover all of the material on this syllabus. Completely in-person sections may still require that you access materials through Blackboard.

Digital Syllabus: An ebook version of this General Biology II Syllabus may be accessed at https://cuny.manifoldapp.org/projects/general-biology-2-syllabus

Digital Course Materials and Study Guide: An ebook version of the General Biology II Course Materials and Study Guide may be accessed at https://cuny.manifoldapp.org/projects/general-biology-2

Labster: This course may use Labster for some of the required laboratory activities. You will be accessing the Labster simulations through the course Blackboard website. In order to see and successfully complete these simulations you must have access to a desktop or laptop computer. These simulations will not work on a tablet or phone.

Proctoring: Instructors may require the use of proctoring software, like Respondus or Proctortrack when students take exams. Proctoring software requires the use of a computer and a webcam. Chromebooks or tablets will work with some software packages.

Recording of Class Sessions: Students who participate in an online class session with their camera on or use a profile image are agreeing to have their video or image recorded solely for the purpose of creating a record for students enrolled in the class to refer to, including those enrolled students who are unable to attend live.  If you are unwilling to consent to have your profile or video image recorded, be sure to keep your camera off and do not use a profile image. Likewise, students who un-mute during class and participate orally are agreeing to have their voices recorded.  If you are not willing to consent to have your voice recorded during class, you will need to keep your mute button activated and communicate exclusively using the "chat" feature, which allows students to type questions and comments live.

Technology: CUNY has created a student technology needs assessment and request form that should be visible when you log into CUNYfirst. Fill this form out to request a loan of a computer or other necessary technology, if you need it.

We expect most class sessions to take place in-person for Fall 2022. Some classes are scheduled to have online or hybrid labs. Here are the GENERAL BIOLOGY LABORATORY POLICIES:

  1. Please turn off all cell phones, etc., before coming to class. The official policy of BCC is that you may not have them on during exams.
  2. Do not eat, drink or chew gum in class since there are some chemicals we use in these laboratories that you do not want in your mouth!
  3. You may not bring children or anyone else to class or leave them outside in the hallway – this is for the safety of your children so please adhere to this policy.

The COVID-19 EMERGENCY and ON-CAMPUS RULES

VACCINATION REQUIREMENTS: All students registering for a fully in-person or hybrid class for the 2021 Fall Term and thereafter must be fully vaccinated to attend in-person classes unless you have been granted a religious exception or medical exemption. For more information, visit the BCC webpage https://www.bcc.cuny.edu/covid-19/. Requests for religious exceptions or medical exemptions must be submitted via the CUNYfirst Vaccine Verification Form. The CUNY mandates are explained here: https://www.cuny.edu/coronavirus/.

CAMPUS REOPENING PLAN:

New Covid-19 health and safety protocols have been implemented to facilitate a safe return to campus.  BCC’s reopening plan can be found http://www.bcc.cuny.edu/bcc-return-to-campus-safely-re-occupancy-plan/   The science indicates that the best protection against the virus is to receive the vaccination for Covid-19, continue masking indoors and in crowded outdoor spaces, and continue practicing social distancing.  Information on the testing locations and other frequently asked questions can be found HERE. 

CAMPUS REENTRY: CUNY is using the Cleared4 system for campus access. Having both the Cleared4 app and the BCC app may be useful when verifying your access to the campus. See this webpage for more details about how to get back on campus: https://www.bcc.cuny.edu/covid-19/

Centers for Disease Control and Prevention (CDC) Guidance: Federal guidelines inform CUNY and BCC public health policy. The CDC Covid-19 website is the best source of information from the federal government about the pandemic: https://www.cdc.gov/coronavirus/2019-ncov/prevent-getting-sick/prevention.html

If you test positive for COVID while taking this course: 

  • Using your BCC email account, please email all your in-person and/or hybrid professors of your status
    • Please include your emplid # and current phone number in your email
    • You can also email your information to healthservices@bcc.cuny.edu
    • Your professor will work with you to complete class work while you are in quarantine.

  • You will be called by a Health Services staffer.  It is critical that you connect with them in a timely matter for contact tracing information.
  • You will need to submit a negative COVID test to HealthServices (healthservices@bcc.cuny.edu) before you are allowed access back to the campus.​

POTENTIAL IN-PERSON LABORATORY ACTIVITIES

Check your class schedule. If this class session is scheduled for in-person or hybrid laboratory sessions, you will use many of the laboratory activities on the following pages. (Online laboratory sections will not have any in-person lab classes.) Your instructor should provide you with a schedule of activities (that conforms to the Laboratory Syllabus earlier in this document) and indicate which laboratory activities will be performed in-person and which activities will be performed in an online setting.

LAB 1.1: Meiosis

Introduction: Meiosis is a special type of nuclear division that is part of cell division that occurs during gamete formation in animals and at separate part of the life cycle in most other eukaryotes. Unlike mitosis, which causes an equal division of chromosomes, meiosis involves the reduction of chromosomes in the cell from the diploid number to the haploid number. This process ensures the maintenance of the correct number of chromosomes for that species from one generation to the next. In addition, it also results in variation that is necessary for the survival of the species.

Purpose: To identify and study the stages of meiosis.

Objectives Checklist: After this lab, the student should be able to:

  • Identify the stages of meiosis.
  • Describe what happens during each stage of meiosis.
  • Understand and explain the processes of independent assortment and crossing over.
  • Compare and contrast meiosis and mitosis.
  • Describe the events of spermatogenesis and oogenesis.
  • Define the following terms: haploid, diploid, homologous chromosomes, synapsis, tetrad, interkinesis, cytokinesis

Pre-Lab: The student should read the following pages in the course materials & study guide and the appropriate pages in the text and in the lab manual (see the Lab Syllabus).

In-class Activities (Use your laboratory notebook to draw, label, and answer questions):

  1. Plant your genetic corn –
    1. Write your name on the outside of your pot.
    2. Fill the pot with moistened potting soil.
    3. Push 2 to 4 seeds into the soil until they are about 1 cm deep. Each seed should be 1 to 2 cm from its nearest neighbor. Make sure that seed is planted right-side-up.
    4. Put your pot in the labeled planting flat under the grow lights.
  2. Cell Division -
  3. Identify the stages of meiosis and describe the activity of each stage of meiosis. i.e. What happens?
  4. Explain the processes of independent assortment of chromosomes and crossing over.
  5. Compare and contrast meiosis with mitosis in a table like the one below.

Mitosis

Meiosis

Number of times chromosomes are copied

Number of cell divisions

Number of daughter cells

Genetic relationship of daughter cells to mother cell

What structures separate during anaphase (Anaphase I in Meiosis)?

Name the function(s) each process performs.

  1. Describe the events of spermatogenesis and oogenesis.
  2. Define the following terms: haploid, diploid, homologous chromosomes, synapsis, tetrad, interkinesis

Study Suggestions:

  1. Explain the difference between chromatin, chromatid, & chromosome.
  2. What events that occur during Prophase I have a major impact on the survival of the species? Explain why these events are important.
  3. Distinguish between interphase, interkinesis, and cytokinesis.
  4. Draw a pair of homologous chromosomes and label the following: chromatid, chromosome, centromere, tetrad.
  5. Draw & label each of the phases of meiosis (for both meiosis I & II), using a cell where 2n=6. Use one color ink to indicate the chromosomes that came from the mother & a different color ink to indicate the chromosomes that came from the father.

QL Activity – Mitosis and Meiosis

  1. For some kinds of experiments, biologists use isolated cells grown in culture. Cells differ significantly in their doubling times (the amount of time it takes for one cell to divide into two cells).

Plant cells can double every

18 hours

Animal cells (matrix requiring) can double every

18 hours

Animal cells (nonmatrix requiring) can double every

14 hours

Yeast cells can double every

2 hours

Bacteria cells can double every

  1. minutes

a) If you start with one cell of each type, which type will have the most cells after 1 week?

i) plant ii) matrix requiring animal iii) nonmatrix animal iv) yeast v) bacteria

  1. If you start with one cell, how many plant cells will there be after 1 week?

i) 29.33 = 644 cells ii) 212 = 4096 cells iii) 284 = 1.93 x 1025 cells iv) 2504 = 5.24 x 10151 cells

  1. If you start with one cell, how many yeast cells will there be after 1 week?

i) 29.33 = 644 cells ii) 212 = 4096 cells iii) 284 = 1.93 x 1025 cells iv) 2504 = 5.24 x 10151 cells

  1. Here is the data for the rate of cell divisions of a Xenopus laevis (an African frog) fertilized egg. The numbers in the first column give total elapsed time in hours from when the egg was fertilized. The first 12 cell divisions are synchronous, meaning they happen at the same time. Graph the data in your lab notebook.

Time (hours)

# of cells

Notes

0

1

Egg is fertilized

½

2

First cleavage

4

64

Polarization

6

10,000

Blastula

10

30,000

Gastrula

19

80,000

Neurula

32

170,000

Somite formation

110

106

Feeding tadpole

  1. How many cell divisions took place in the first 4 hours?

i) 0 ii) 2 iii) 4 iv) 6 v) 8

  1. How many cells exist after 12 cycles (12 cell divisions)?

i) 2 ii) 64 iii) 4096 iv) 10,000

  1. Using your graph, which of the seven time intervals has the most rapid rate of cell division (increase in the number of cells in a time interval? [HINT: On the graph, the rate is higher if the slope is steeper.]
  2. 0 to ½ hours ii) 4 to 6 hours iii) 10 to 19 hours iv) 32 to 110 hours
  3. In the human brain, an estimated average rate of 250,000 nerve cells are produced each minute during gestation and through 6 months after birth.
    1. How many nerve cells are in a healthy 6-month-old human brain?
      1. 1.62 x 108 nerve cells ii) 1.62 x 1011 nerve cells iii) 1.62 x 1014 nerve cells
  4. One of the earliest stages of fertilization that can be measured in a sea urchin egg is depolarization of the membrane around the egg. This occurs in 2 seconds. Egg and sperm nuclei fuse at around 1200 seconds and the first division of the zygote is at 5500 seconds.
    1. How many times longer does the process of nuclear fusion take than membrane depolarization?
      1. 2 times ii) 100 times iii) 600 times iv) 1200 times
    2. What is the maximum amount of time needed to synthesize a complete set of chromosomes in the sea urchin zygote prior to its first division?
      1. 2 seconds ii) 1198 seconds iii) 1200 seconds iv) 4300 seconds v) 5500 seconds

LAB 1.2: Human Karyotype

Purpose: To demonstrate an understanding of chromosomal inheritance, including linked genes, sex-linked genes, and chromosomal abnormalities

Objectives Checklist:

  • Define the following: chromosomal packing, Barr body, karyotype, monosomy, trisomy, haploid, diploid, nondisjunction, deletion, inversion, duplication, translocation
  • Assemble and Use a karyotype to determine the sex of an individual and whether that individual has any chromosomal abnormalities
  • Distinguish among the following chromosomal abnormalities, explain the exact difference in the chromosomes and the symptoms of any associated syndromes: Edward Syndrome, Down Syndrome, Cri du chat (or Le Jeune’s) Syndrome, Jacob’s Syndrome, Turner’s Syndrome, Kleinfelter’s Syndrome
  • Define sex-linked genes and explain how to determine if a gene is sex-linked. Distinguish between X-linked genes and Y-linked genes.
  • Relate the Laws of Segregation and Independent Assortment to Meiosis
  • Explain the Chromosomal Theory of Inheritance and demonstrate an understanding of linked genes and their relationship to crossing over

Pre-Lab: The student should read the following pages in the course materials & study guide and the appropriate pages in the text and in the lab manual (see the Lab Syllabus). Provide a definition for each of the vocabulary terms (in bold text) in the objectives list above.

In-Class Activities (Use your laboratory notebook to make drawings and answer questions):

Human karyotype lab

You and your partner are doctors. You have just completed an amniocentesis for a patient and will use the information from the cells you have extracted to determine the karyotype of the patient’s fetus. You will then inform the patient of the results of this test in a letter.

Instructions:

  1. Take one of the chromosome sets (handed out in class by your instructor). Your goals are to:
    1. Determine how many chromosomes are present.
    2. Determine the sex of the individual (by looking at the numbers of X and Y chromosomes).
    3. Determine if the individual has a chromosomal disorder, and, if so, what that disorder is. No chromosome set manifests more than one disorder.
  2. Write both your name and your partner’s name on the Human Karyotype Form on pg. 54, as well as the number of the chromosome set that you were assigned.
  3. Construct a karyotype with your partner by cutting out the chromosomes and arranging them correctly on the Human Karyotype Form: One student should cut out all of the chromosomes while the other matches them with the chromosomes in Figure 10.1 on pg. 55 (hint: look at the size of the chromosome and the black and white banding patterns). Once a match is made, place the chromosome on the correct number on the karyotype form provided. You should have two chromosomes for each autosome and two sex chromosomes.
  4. Based on the karyotype you have constructed, determine the sex of the fetus and what disorder the fetus has, if any. You may use the lab manual, the text book or any print or online sources that you deem reliable.
  5. Write a letter to the parents of the baby you have just karyotyped. You are informing these people of your findings as though you were the doctor analyzing the results. Remember, someone will be reading this letter and they are very involved. Be tactful, complete, and direct. As a doctor, you should give them the following information:
    1. Information about the results of the test
    2. Information about the disorder the child has
    3. Options available to the parents now that they have all of the information
    4. Any advice you feel is needed

Suggested Study Questions:

  1. What is a karyotype?
  2. Explain why staining of chromosomes is important in karyotyping.
  3. How can karyotyping be useful in determining a fetus’s phenotype?
  4. What are some of the limitations of karyotyping?
  5. Define trisomy. Define monosomy.
  6. Define non-disjunction.
  7. In a species with a diploid number of 16, how many total chromosomes would be present in a diploid cell of an organism with a monosomy?
  8. What is a Barr body? How many Barr bodies does a woman born with three X chromosomes have?

Identify the chromosomes from the chromosome set on your sheet by matching them to the chromosomes in the karyotype below.

karyotype 1

FIGURE 10.1 – A KARYOTYPE: This diagram illustrates the karyotype from a human cell – diagrams for 24 chromosomes are shown (the 22 autosomes, and the 2 sex chromosomes). Most normal cells in the human body contain 22 pairs of chromosomes and the two sex chromosomes (2n = 46). The total number of chromosomes in each nucleated cell is 46, except for gametes. Many genes are located on each chromosome.

LABS 2.1 & 2.2: Animal Development – Sea Star & Frog and Chick & Human

Purpose: To identify and study the stages of sea star and frog development. To identify and study the stages of chick and human development.

Introduction: In animals, fertilization, the union of egg and sperm cells, is followed by development. Whether the prenatal development occurs in relatively simple or complex forms of animals, there are certain events that are common in both. Germ layer formation and, following that, morphogenesis proceed along similar developmental pathways in most animals. This similarity is significant because it is one of the many pieces of evidence supporting the theory of evolution and of the common heritage of all species. PLEASE NOTE: On p. 554, the textbook incorrectly identifies pregnancy as beginning at fertilization. Fertilization and pregnancy are separate events. The condition of pregnancy begins at implantation of the embryo.

Objectives Checklist:

  • Identify the following stages of development in the sea star: cleavage, morula, blastula, gastrula.
  • Identify the following structures of a sea star during development: blastomere, blastocoel, archenteron, blastopore, ectoderm, endoderm, mesoderm.
  • Identify the following stages of development in the frog: cleavage, morula, blastula, gastrula, neurala.
  • Identify the following parts of a frog during development: blastomere, blastocoel, archenteron, blastopore, ectoderm, endoderm, mesoderm, neural fold, neural groove, neural tube, notochord.
  • Identify the parts of the chicken during development: primitive streak (18 h), Hansen’s node (18 h), notochord (18h, 24h), head folds (24h), neural fold (24h), somites (24h, 33h, 48h), optic vesicle (33h), brain (33h, 48h), heart (ventricle – 33h), eyes with lens (48h), gill slits (48h), heart (48h), vitelline arteries & veins (48h), tail bud (48h).
  • Identify the parts & stages of human development: zygote, cleavage, morula, blastocyst, trophoblast, inner cell mass, chorion, yolk sac, amnion, allantois, umbilical cord, limb buds.

Pre-Lab: The student should read the following pages in the course materials & study guide and the appropriate pages in the text and in the lab manual (see the Lab Syllabus). Provide a definition for each structure and explain the function of each of the vocabulary terms (in bold text) in the objectives list above.

Slides:

Animal

Slide #

Topic

Frog

9

Zygote

Frog

10

Early cleavage

Frog

11

Blastula

Frog

12

Gastrula

Frog

13

Neural fold

Frog

14

Neurula

Sea star

28

Early cleavage

Sea star

29

Blastula

Sea star

30

Gastrula

In the last set of slides (all the way to the left in 603) – there are slides not listed on the list for the Bio 11 lab manual. These slides contain sections & whole chick embryos at various development times (ex. 18h, 72h, etc.). In the study lab, these slides are in two trays at the bottom of the Bio 11 slide box.

Slide #

Time

pp. 33-34 (chick handout)

12-7 or 207

18 h

D

12-9 or 209

24 h

E

12-11 or 211

33 h

F

12-13 or 213

48 h

G

12-15 or 215

72 h

H

12-17 or 217

96 h

I

In-Class Activities:

In your laboratory notebook, define and describe the function each of the vocabulary terms in the objectives list above. Be clear whether it is at developmental STAGE, PROCESS, or STRUCTURE. Then, indicate in which of the organisms the term can be found.

Study Suggestions:

  1. Explain the following statement: “Ontogeny recapitulates phylogeny.”
  2. Using the Critical Thinking Method answer the following question: which of the following statements is TRUE? Explain your answer.
    1. Four chambered hearts develop in all frogs.
    2. Neuralation occurs in all relatively complex organisms.
    3. All organisms have a development time of 9 months.
  3. Draw & label the following processes & stages of the sea star & the frog: cleavage, morula, blastula, gastrula, neurula (frog only).
  4. What is a notochord? Why is the development of a notochord important?
  5. What is a neural tube? Why is the development of the neural tube important?
  6. What is a somite? Why is the development of somites important?

LAB 3.1: Genetics – Face Lab and Simple Genetics Problems

Purpose: To become familiar with and acquire the skills to solve genetics problems that involve 1 or more genes, and that illustrate the following concepts: complete dominance, incomplete dominance, 3 or more alleles, and codominance.

Objectives Checklist:

  • Explain the following terms: hybrid, gamete, cross, P generation, F1 generation, F2 generation, self-fertilized, cross-fertilized, phenotype ratio, genotype ratio, dominant, recessive
  • Perform a monohybrid cross
  • Identify homozygous & heterozygous individuals
  • Distinguish genotype from phenotype
  • Demonstrate an understanding of the role of probability in genetics
  • Perform a dihybrid cross
  • Identify and Demonstrate the following modes of inheritance: complete dominance, incomplete dominance, codominance, multiple alleles, pleiotropy, polygenic inheritance, epistasis
  • State and Explain the Law of Segregation
  • State and Explain the Law of Independent Assortment
  • Relate the Laws of Segregation and Independent Assortment to Meiosis

Pre-Lab: The student should read the following pages in the course materials & study guide and the appropriate pages in the text and in the lab manual (see the Lab Syllabus). Provide a definition for each of the vocabulary terms (in bold text) in the objectives list above.

In-Class Activities: Work in small groups to learn about probability from a simulation (The Face Lab) and solve assigned problems from the genetics problems below (Simple Genetics Problems). Write both the questions and their solutions in your laboratory notebook.

The Face Lab

Introduction:

Have you ever wondered why so much variation in appearance is present even when people are closely related? There is a large variation of human traits and this variation increases as they reproduce. Even close relatives such as a siblings can vary widely in their appearance, and yet one or both may closely resemble a grandparent, great uncle, or cousin. How does this variation occur and where do our human traits come from? To answer these questions, you are about to become parents, so begin thinking about what you will name your child, and think about the expectations parents have for their offspring.

What might your baby look like if both you and your “spouse” had one dominant allele and one recessive allele for each of the genes of the facial features illustrated in the following pages? In other words, each of you (the parents) will be heterozygous for each trait. For example, for a gene in which the dominant allele is R and the recessive allele is r, both parental genotypes are Rr. To determine the traits of “your child,” you and your “spouse” will each flip a coin (to simulate random selection of a gene) to determine which trait or bit of information you will contribute to your “child.” Heads will represent DOMINANT traits (shown with a capital letter) and tails will represent RECESSIVE traits (show with a lowercase letter). Each parent will flip a coin to determine which allele of each gene pair that you will contribute. Therefore, each child will get two alleles for each trait – one from each parent. Record the genetic contributions of each parent in the chart provided. When you have determined all of the features for a particular trait, eyes, for example, draw and color the way the baby will look. You and your “spouse” will produce one “child.”

Most of the traits in this activity were created to illustrate how human heredity works in a simplified model and to reinforce basic genetic principles. In actuality, inherited characteristics of the face are much more complicated than this activity illustrates. Most of the facial characteristics are determined by many genes working together in a way geneticists do not yet understand.

Your first task as parents is to record your names on the data sheet. Next, you will determine the sex of the child. Which parent should flip a coin to determine the sex of the child? The female contributes the egg and each egg contains the X sex chromosome because females have two X chromosomes. The male sperm may have an X chromosome or a Y chromosome. Heads will represent a Y-bearing chromosome and tails will represent an X-bearing sperm. Give your child a name and record it on your data sheet.

Face Lab Data Sheet

Father: ____________________________ Mother: ___________________________

Child’s Name: _____________________________ Sex: Male / Female

#

Trait

Allele from Mother

Allele from Father

Genotype

Phenotype

1

Face Shape

2a

Chin Prominence

2b

Chin Shape

2c

Cleft Chin

3

Skin Color

4

Hair Type

5

Widow’s Peak

6a

Eyebrow Color

6b

Eyebrow Thickness

6c

Eyebrow Placement

7

Eye Color

8a

Eye Distance Apart

8b

Eye Size

8c

Eye Shape

8d

Eye Angle

9

Eyelashes

10

Mouth Size

11a

Lips - Thickness

11b

Lips – Protrusion

12

Dimples

13a

Nose Size

13b

Nose Shape

13c

Nostril Shape

14a

Earlobe Attachment

14b

Earpoint

14c

Earpits

14d

Ears – hairiness

15

Freckles – cheeks

16

Freckles – forehead

Instructions:

  1. Record your name and your “spouse’s” name on the data sheet. Decide which parent will be the mother and which will be the father.
  2. Determine the sex of your child by flipping a coin to determine which sex chromosome will be in the sperm. Record the sex of your child on the data sheet.
  3. Name your child. Record the name on your data sheet.
  4. For each of the following traits, each parent should flip a coin to determine whether the allele they give to the child is dominant (capital letter) or recessive (lowercase letter):

  1. Skin Color: To determine the color of skin, assume there are three gene pairs involved. Flip your coins first to determine the genotype of the first pair of alleles (AA, Aa, aa). Then flip your coins again to determine the genotype of the second pair of alleles (BB, Bb, bb). Flip for the last time to determine the third pair of genes (CC, Cc’, c’c’). If your gene pairs are – I –, then the skin color is – II –.

Each capital letter represents an active allele for pigmentation.

– I –

– II –

– I –

– II –

6 capitals

Very dark black

2 capitals

Light brown

5 capitals

Very dark brown

1 capital

Light tan

4 capitals

Dark brown

No capitals

White

3 capitals

Medium brown

  1. Eye Color: Darker eyes are produced in the presence of more active alleles. In this situation, the large letters (A or B) represent alleles which are active in depositing dark pigment. Small letters (a or b) represent alleles which deposit little pigment.

To determine the color of the eyes, assume there are two gene pairs involved, one which codes for depositing pigment in the front of the iris and one which codes for depositing pigment in the back of the iris. Determine the genotype of the first pair (AA, Aa, aa) and then the second pair (BB, Bb, bb). If your genotype is – I –, the eye color is – II –. In reality, the determination of eye color is much more complicated.

– I –

– II –

– I –

– II –

AABB

Dark brown

Aabb, aaBb

Light blue

AABb, AaBB, AaBb

Brown

aabb

Pale blue

AAbb, aaBB

Dark blue

Questions to Consider:

  1. Find another couple and compare your child with theirs.
    1. Describe at least 5 traits that your children have in common.
    2. Describe at least 5 traits that your children do not have in common.
    3. How do you account for these differences?
  2. Explain how your child could have your grandmother’s freckles.
  3. What are the chances (What is the probability) that your child will get a recessive gene from both you and your spouse?
  4. Describe a trait that is incompletely dominant. How are the phenotypes of this trait different from those of completely dominant traits?
  5. What accounts for the great variation in skin color? How is the color of the skin determined?
  6. Describe an instance from this activity in which you saw epistatic interactions. Define epistasis and explain how the traits you’ve chosen illustrate this process.
  7. If it were possible for you as a parent to determine what traits your child would get, describe the major traits you would choose and explain why.
  8. Assuming that scientists have discovered how to select the genes for your offspring and that the citizens of this country will vote to determine if it is legal, how will you vote? Defend your position.
  9. Scientists have identified the location of all the genes for all human traits (over 100,000 of them). Spending money on this project (Human Genome Project) was very controversial. Think of at least three reasons for this research and three reasons against this research.
  10. Your state has just passed a law that parents can determine the mate for their child. Your child is now 25 years old and it is time for you to pick his mate. Find another child in the classroom, and when you and the child’s parents agree that this is a good match, use the genotypes of these two children to produce your grandchild. Make a chart similar to the one you did for your child.

The following concepts can be explained and illustrated using this activity:

  1. Each parent contributes one half of each child’s genetic makeup: haploid & diploid
  2. Genotype and phenotype
  3. Incomplete dominance
  4. Mendelian ratios
  5. Principles of unit characters, dominance, segregation, random assortment, and probability
  6. Polygenic inheritance
  7. Sex-limited trait
  8. Epistasis
  9. Gene frequency
  10. Chi-square analysis

Genetics Practice Problems – Simple Worksheet

(from http://www.biologycorner.com/worksheets/basicgenetics.htm, 10/02/2002)

  1. For each genotype below, indicate whether it is heterozygous (He) or homozygous (Ho):

AA _____

Ee ____

Ii _____

Mm _____

Bb _____

ff ____

Jj _____

nn _____

Cc _____

Gg ____

kk _____

oo _____

DD _____

HH ____

LL _____

Pp _____

  1. For each of the genotypes below determine what phenotypes would be possible:

Purple flowers are dominant to white flowers.

PP __________________

Pp __________________

pp __________________

Round seeds are dominant to wrinkled seeds.

RR __________________

Rr __________________

rr __________________

Brown eyes are dominant to blue eyes

BB ________________

Bb ________________

bb ________________

Bobtails in cats are recessive.

TT _________________

Tt _________________

tt __________________

  1. For each phenotype below, list the genotypes (remember to use the letter of the dominant trait):

Straight hair is dominant to curly.

____ straight

____ straight

____ curly

Pointed heads are dominant to round heads.

_____ pointed

_____ pointed

_____ round

  1. Set up the Punnet squares for each of the crosses listed below. Round seeds are dominant to wrinkled seeds.

Rr x rr

What percentage of the offspring will be round? ______________

RR x rr

What percentage of the offspring will be round? ______________

RR x Rr

What percentage of the offspring will be round? ______________

Rr x Rr

What percentage of the offspring will be round? ______________

Practice with Crosses. Show all your work.

  1. A TT (tall) plant is crossed with a tt (short) plant. What percentage of the offspring will be tall? ____________
  2. A Tt plant is crossed with a Tt plant. What percentage of the offspring will be short? _____________
  3. A heterozygous round seeded plant (Rr) is crossed with a homozygous round seeded plant (RR). What percentage of the offspring will be homozygous (RR)? __________
  4. A homozygous round seeded plant is crossed with a homozygous wrinkled seeded plant. What are the genotypes of the parents? ________ _______ What percentage of the offspring will also be homozygous? ___________
  5. In pea plants purple flowers are dominant to white flowers. If two white flowered plants are crossed, what percentage of their offspring will be white flowered? _______________
  6. A white flowered plant is crossed with a plant that is heterozygous for the trait. What percentage of the offspring will have purple flowers? _______________
  7. Two plants, both heterozygous for the gene that controls flower color are crossed. What percentage of their offspring will have purple flowers? ________________What percentage will have white flowers? _____________
  8. In guinea pigs, the allele for short hair is dominant. What genotype would a heterozygous short haired guinea pig have? _____________ What genotype would a pure-breeding short-haired guinea pig have? _____________ What genotype would a long-haired guinea pig have? _______________
  9. Show the cross for a pure-breeding short-haired guinea pig and a long-haired guinea pig. What percentage of the offspring will have short hair? ____________
  10. Show the cross for two heterozygous guinea pigs. What percentage of the offspring will have short hair? ____________ What percentage of the offspring will have long hair? _____________
  11. Two short-haired guinea pigs are mated several times. Out of 100 offspring, 25 of them have long hair. What are the probable genotypes of the parents? ____________ Show the cross to prove it.

LAB 3.2: Practice Genetics Problems

Purpose: To become familiar with and acquire the skills to solve genetics problems that involve 1 or more genes, and that illustrate the following concepts: complete dominance, incomplete dominance, 3 or more alleles, codominance, polygenic inheritance, epistasis, and sex-linked traits.

Objectives Checklist:

  • Explain the following terms: hybrid, gamete, cross, P generation, F1 generation, F2 generation, self-fertilized, cross-fertilized, phenotype ratio, genotype ratio, dominant, recessive
  • Perform a monohybrid cross
  • Identify homozygous & heterozygous individuals
  • Distinguish genotype from phenotype
  • Demonstrate an understanding of the role of probability in genetics
  • Distinguish between a mutation & a wild type gene
  • Perform a dihybrid cross
  • Identify and Demonstrate the following modes of inheritance: complete dominance, incomplete dominance, codominance, multiple alleles, pleiotropy, polygenic inheritance, epistasis, chromosomal: linked & sex-linked
  • State and Explain the Law of Segregation
  • State and Explain the Law of Independent Assortment
  • Relate the Laws of Segregation and Independent Assortment to Meiosis

Pre-Lab: The student should read the following pages in the course materials & study guide and the appropriate pages in the text and in the lab manual (see the Lab Syllabus). Provide a definition for each of the vocabulary terms (in bold text) in the objectives list above.

In-Class Activities: Work in small groups to solve assigned problems from the genetics problems below (More Genetics Problems and Difficult Genetics Problems). Write both the questions and the answers in your laboratory notebook.

MORE GENETICS PROBLEMS

  1. When tall plants mate with dwarf plants, only tall plants occur in the offspring. Assign symbols and show the phenotypes and genotypes in the parental (P) and first filial generations for a cross between tall plants and dwarf plants that produces only tall plants.
  2. Show the expected outcome when the F1 plants in problem #1 are crossed. Be sure to give both phenotype and genotype ratios for these second filial (F2) generation plants.
  3. Assume that in aardvarks gray fur dominates over brown fur. If, in a certain litter, half of the offspring show gray fur and half brown fur, indicate what the parents’ genotypes and phenotypes probably were.
  4. In humans, six fingers (F) is the dominant trait over five fingers (f). This illustrates the often overlooked fact that dominance does not necessarily mean commonness of occurrence. If both parents are heterozygous for six fingers, what is the probability of their having six-fingered children? Five-fingered children?
  5. In one of his experiments, Mendel crossed plants with round, yellow seeds with plants having wrinkled, green seeds. The resulting plants all had round, yellow seeds. When these seeds were used, the plants growing from them were crossed among themselves, and the offspring showed 4 phenotypes. 315 of the seeds were round and yellow, 101 were wrinkled and yellow, 108 were round and green, and 32 were wrinkled and green. Use appropriate symbols and method to explain these results.
  6. In the Japanese four o’clock, flower color results from genes showing incomplete dominance or blending. For example, a cross between a homozygous red and a homozygous white will always result in a pink flower. What is the probable outcome (offspring phenotypes) of a cross between two pink flowers? Between a red and a pink flower?
  7. In horses, black color (B) dominates over chestnut color (b) and the trotting gait (T) dominates over the pacing gait (t). Give the expected genotype(s) and phenotype(s) of the offspring from a cross between a horse homozygous for chestnut color and the trotting gait and a horse homozygous for black color and the pacing gait. Then, explain the probable outcome of a cross between the offspring of the first cross.
  8. In humans, the presence of a certain protein in the blood (Rh+) is dominant over the absence of this protein (Rh–). Normal production of insulin is dominant over abnormal insulin production. If both parents are heterozygous for Rh+ blood and normal insulin production, what possible phenotypes could they produce? In what ratio?
  9. Suppose a father is homozygous for Rh+ blood and has diabetes, and the mother has Rh– blood and is homozygous normal for insulin. What probable phenotypes would they produce?
  10. In the radish plant, the long and round traits are incompletely dominant and the result is oval plants. The red and white color traits are also incompletely dominant, with heterozygotes producing a purple color. Show the expected result of a cross between two purple, oval-shaped radish plants. What type of inheritance does this example illustrate?
  11. In certain breeds of dogs, black coat color dominates over red color, and a solid coat dominated over a spotted coat. If a homozygous black-and-white spotted male mates with a red-and-white spotted female, what is the probability of their producing a solid, black puppy?
  12. In humans, the allele for type A blood and the allele for type B blood show codominance. Someone with both alleles has AB blood. Both type A and type B dominate over type O blood. Explain the probable outcomes of a cross between someone carrying alleles for type A and type O blood with someone carrying the alleles for type B and type O blood.
  13. Mrs. Doe and Mrs. Roe both gave birth at the same hospital at the same time. Mrs. Doe took home Nancy and Mrs. Roe took home Richard. However, Mrs. Roe was sure she had a girl and sued the hospital for switching the babies. Blood tests found that Mr. and Mrs. Doe were both type B, Mrs. Roe was type O, and Mr. Roe was type AB. Nancy was type A and Richard was type O. Had a switch occurred?
  14. A young lady with type O blood gave birth to a baby with type O blood. She claimed that a young man with type A blood was the father. Could he be? Can it be proven on this evidence alone? Explain.
  15. The allele for normal color vision dominates the allele for color-blindness, and both are carried on the X chromosome. What are the chances that, if a colorblind man marries a woman who is a carrier for color-blindness and they have a son, he will have normal vision? Explain.
  16. Using the information given in problem #15, explain the chances of a daughter of the couple having normal vision. What are the chances of her being a carrier?
  17. Hemophilia is another sex-linked trait. Suppose a man with normal blood clotting marries a woman who is a carrier for hemophilia. Explain the possible genotypes and the probability of the appearance of these phenotypes in their children.
  18. In certain strains of wheat, color is caused by two sets of genes. Both dominant alleles, R and B, are needed for red color. A white color results from both recessive alleles in the homozygous state (rrbb). Any other combination produces a brown color. Suppose that a strain with the genotype Rrbb is crossed with a strain having the genotype rrBb. Explain the color of each parent strain and the possible colors in resulting offspring.
  19. Normal pigmentation dominates no pigmentation (albinism). In certain breeds of cattle, in order to show coat color there must be both a gene for pigmentation and genes for a specific color. Consider the following situation: an albino bull that has heterozygous genotype for red color mates with a cow that is heterozygous for both pigmentation and red color. Please note, brown is dominant over red. What types of offspring could they produce and what is the probability of each type?
  20. Sickle-cell anemia is a recessive genetic condition that causes red blood cells to become distorted. Insufficient oxygen will be carried in the blood of homozygous recessive individuals and victims usually die at an early age (without treatment). What is the probability that two people who are carriers of this trait will have a child with sickle-cell anemia?
  21. Tay-Sachs disease, like sickle-cell anemia, involves a homozygous recessive condition. Victims of this disease seem to be developing normally, but at about eight months, a red spot appears in the eye, development begins to slow, and over the next few years, fatty deposits build up in the brain as the child’s mental development ceases, until death occurs at an early age. What is the probability that a child will inherit Tay-Sachs disease if the father is a carrier and the mother has no allele for this condition?
  22. In humans, brown eyes are dominant and blue eyes are recessive. A brown-eyed couple has a brown-eyed boy and blue-eyed girls. What can be concluded about the genotypes of parents and children?
  23. In rabbits, short fur is due to a dominant allele, L, and long fur to a recessive allele, l. Black color (B) dominates over white color (b). Two rabbits produced 2518 short-haired, black and 817 long-haired, black offspring. What are the probable genotypes of the parents?
  24. Two parents produce only daughters who are carriers of hemophilia and sons who are normal for blood clotting. What are the parents’ probable genotypes?
  25. Deafness in humans may be due to a homozygous condition of either or both genes, d and e. Both dominant alleles, D and E, are needed for normal hearing. Two deaf people marry and have children, all of whom have normal hearing. Explain the probable genotypes of the parents and children.

Difficult Genetics Problems:

  1. A rare white bison was born in a bison rancher’s herd. When it matured the rancher mated it to normal bison on three different occasions, and each time a normally colored bison was born. When those new bison grew up, two of them were mated to each other. All their calves were brown except one, which was white like its grandparent. Summarize each of these crosses.
  2. Farmer MacGregor has a prize pig named Honey, which has won many honors at the State Fair. Several other farmers want to mate their pigs with Honey so that they could have prize-winning pigs. Farmer MacGregor knows that some of Honey’s litter mates were runts and that the failure to grow properly is due to a recessive allele. What could Farmer MacGregor do to find out for certain what Honey’s genotype is?
  3. In humans hair color is controlled by two interacting genes. The same pigment, melanin, is present in both brown-haired and blond-haired people, but brown hair has much more of it. Brown hair is dominant to blond. Whether melanin can be synthesized depends on another gene. The dominant form allows synthesis, the recessive prevents melanin synthesis. What will be the expected proportions of phenotypes in the children of parents who are heterozygous for both characteristics?
  4. A man is heterozygous for an allele for sickle cell anemia, which is expressed only when homozygous. His wife is also heterozygous for sickle cell anemia. What is the probability that a first child will be a son with sickle cell anemia? What is the probability that their first child will be a normal daughter?
  5. A true-breeding radish with long red roots was crossed to a true-breeding radish with round white roots. The F1 radishes were all oval purple. What would be the ratio of all the possible phenotypes among the F2 produced by crossing two of the F1 radishes?
  6. The first allele discovered by Drosophila geneticists was the recessive white-eye allele, which is sex-linked. The normal eye color is red. A red-eyed male was crossed to a white-eyed female and a white-eyed male was crossed to a red-eyed female. All the parents are from true-breeding lines. What kinds of offspring will be found in EACH case?
  7. It was first thought that the albino locus in rabbits consisted of only two alleles, the wild type and the recessive. Recessive homozygotes lack melanin and have white hair and pink eyes. Evidence has shown that there are several other alleles of this locus. The Himalayan allele produces rabbits with light bodies and dark noses. It is dominant to albino. The chinchilla allele produces a coat that is lighter than the wild type but darker than the Himalayan and it produces a “light gray” coat when heterozygous with the recessive or the Himalayan. The wild type allele is dominant to all three of the other alleles. What are the types of coat color that will be seen in the offspring of a cross between a wild colored rabbit that is heterozygous for Himalayan color and a chinchilla rabbit that is heterozygous for albinism?
  8. Among the tigers at the Big Cat house of the National Zoo in Washington, D.C., there are two yellow-coated parents, Ghandi and Sabrina. They gave birth to a cub Snowflake that has a rare color variation – a white coat with black stripes. What are the genotypes of all the tigers, Ghandi, Sabrina and Snowflake?
  9. In a fruit fly Drosophila is heterozygous for the recessive alleles e (ebony), f (forked bristles), t (temperature sensitive), and v (vestigial wings), what are all the kinds of gametes that the fly can produce?
  10. In poultry, barring is due to a dominant sex-linked gene while non-barring is due to the recessive. Crested head is due to dominant autosomal gene and plain head is due to its recessive allele. Two barred crested birds were mated and produced two offspring: a non-barred plain male and a barred crested female. Give the genotypes of the parents. Summarize the expected results for sex, barring and crest expressions from further matings between these two barred crested birds.

LAB 4.1: Domains Bacteria and Archaea – the Prokaryotes

Purpose: To identify and study the characteristics of different representatives of the Domains Bacteria and Archaea.

Introduction: Taxonomy is the science by which organisms are classified and placed into different groups based on their evolutionary relationships. The smallest group of organisms in taxonomy is the species – organisms that can interbreed and produce fertile offspring in nature. Closely related species are placed in the same genus. Together, the genus and species names are called the scientific name (binomial name) of an organism. There are more species in higher levels of organization with the highest level being the domain. We determine who is most closely related to whom using anatomy, development, behavior, biochemistry and genetics. Today most changes in taxonomy and most new advances come from studies of the genetics of living organisms.

All species are placed in three domains that are separated by differences in their biochemistry and cell structure. The Domains Bacteria and Archaea include unicellular prokaryotic organisms previously referred to as bacteria and blue-green algae. Most are only a few micrometers in diameter, larger than viruses but smaller than eukaryotic cells. Nearly all prokaryotes are encased in a porous but rigid cell wall that prevents their rupture in watery environments and gives them a characteristic shape. Currently, Domain Bacteria is divided into five major groups: proteobacteria, gram-positive bacteria, cyanobacteria, chlamydias, and spirochetes.

Objectives Checklist:

  • Identify the characteristics of prokaryotes
  • Identify the characteristics of the Domain Bacteria
  • Recognize the three shapes of bacteria: bacillus, coccus, spirillum
  • Define the following modes of nutrition: heterotrophy, photoautotrophy, chemoautotrophy
  • Identify the characteristics of the Phylum Cyanobacteria
  • Identify the following Cyanobacteria: Nostoc, Oscillatoria

Pre-Lab: The student should read the following pages in the course materials & study guide and the appropriate pages in the text and in the lab manual (see the Lab Syllabus). Provide a definition for each of the vocabulary terms (in bold text) in the objectives list above.

Slides:

Domain:

Phylum:

Slide

Genus

Description

Bacteria

Cyanobacteria

#33

Gleocapsa

colonies

Bacteria

Cyanobacteria

#35

Oscillatoria

Filamentous colonies

Bacteria

#47

3 shapes of bacteria

Bacteria

Cyanobacteria

#34

Nostoc sec.

Filamentous colonies

In-class activities (Use your laboratory notebook to make drawings and answer questions):

  1. Look at each of the slides under the microscope. Draw the visible structures and label the visible parts.
  2. Look at each of the live organisms (make the wet mount slides, as needed). Draw the visible structures and label the parts.

Study Suggestions:

  1. List the three domains and four kingdoms of the Domain Eukarya and give the major characteristics of EACH domain and kingdom.
  2. Draw a diagram that shows the relationship between the 3 domains & 4 kingdoms.
  3. Draw and label each of the three bacterial shapes that you are responsible for.
  4. Why are cyanobacteria unique among the bacteria? How did they change the world?
  5. Draw and label a representative of Nostoc.
  6. Draw and label a representative of Oscillatoria.

QL Activity – Prokaryotes

  1. The age of the Earth is estimated from the amount of uranium isotope 238 remaining. Radioisotopes like U238 slowly decay over time turning into either another isotope or another element when they release radiation. Estimates are that only half of the U238 that was originally present in the Earth still exists. Since the half life (time it takes a radioisotope to lose ½ its material) is 4.5 x 109, that puts the age of the Earth at 4.5 billion years. U238 decays into Th234, which decays into Pa234, which decays into U234.

The earliest fossil evidence of bacteria is 3.5 billion years old. Vascular plants began to appear 400 million years ago. Modern humans are estimated to have appeared about 200,000 years ago.

    1. At which of these times would the most original U238 remain?
      1. The time bacteria first became fossilized
      2. The time vascular plants appeared
      3. The time modern humans appeared
    2. At which of these times would the least original U238 remain?
      1. The time bacteria first became fossilized
      2. The time vascular plants appeared
      3. The time modern humans appeared
  1. Fossils found in rock suggest that:

Life started on Earth

3500 million years ago

Plants live on land

400 million years ago

Flowering plants (monocots) evolve

80 million years ago

Dinosaurs begin to go extinct

65 million years ago

Modern humans evolve

180,000 years ago

Compare these time spans by changing the scale from YEARS to SECOND: let 1 year = 1 second. Thus, in this scale the average biology student is 20 seconds old.

    1. At this scale, how many days ago did humans appear?
      1. 1.7 hours ii. 1 day iii. 1.7 days iv. 2 days v. 2.7 days
    2. How many years ago did the dinosaurs vanish?
      1. 2 years ii. 2.1 years iii. 2.2 days iv. 2.3 days v. 2.4 days
    3. How many years ago did flowering plants begin to dominate?
      1. 1.5 years ii. 2 years iii. 2.5 years iv. 3 years v. 3.5 years
    4. How many years ago did plants start to live on land?
      1. 10 years ii. 11 years iii. 12 years iv. 13 years v. 14 years
    5. How many years ago did cells first fossilize?
      1. 91 years ii. 111 years iii. 121 years iv. 131 years v. 141 years
  1. Evolution occurs in jumps. An E.coli culture was maintained for 10000 generation over 4 years. The liquid medium was changed daily to maintain a constant environment.

The average size of the cells at the start of the experiment was 3.5 x 10-15 liter. After 300 generations the size increased to 0.48 x 10-15 liter, and after another 300 generations the average increased to 0.49 x 10-15 liter. After 1200 generations it increased to 0.58 x 10-15 liter and remained so until the end of the experiment.

e coli evolution graph from biomath

    1. How many hours long is a generation for E.coli?
      1. 3.5 min ii. 3.5 hours iii. 3.5 days iv. 3.5 years
    2. What was the average size change over the course of the experiment?
      1. 2.3 x 10-10 L ii. 2.3 x 10-12 L iii. 2.3 x 10-14 L iv. 2.3 x 10-16 L
    3. What was the average size change in the first 300 generations?
      1. 1.3 x 10-14 L ii. 1.3 x 10-15 L iii. 1.3 x 10-16 L iv. 1.3 x 10-17 L
    4. How fast did the size increase over the course of the experiment in liters per generation?
      1. 2.3 x 10-20 L / gen. ii. 2.3 x 10-18 L / gen. iii. 2.3 x 10-16 L / gen.
    5. How fast did the size increase over the course of the experiment in liters per year?
      1. 5.8 x 10-19 L / year ii. 5.8 x 10-18 L / year iii. 5.8 x 10-17 L / year
    6. How fast did the size increase over the first 300 generations in liters per generation?
      1. 4.33 x 10-18 L / gen. ii. 4.33 x 10-19 L / gen. iii. 4.33 x 10-20 L / gen.
    7. How fast did the size increase over the first 300 generations in liters per year?
      1. 1.08 x 10-13 L / year ii. 1.08 x 10-15 L / year iii. 1.08 x 10-17 L / year
  1. Eating habits have changed with advances in food processing and transportation. This processing and transportation allow for the potential of bacterial contamination. The Public Health Laboratory Service in England has suggested guidelines for some ready-to-eat foods. The process is to collect 1 gram of the food and determine how many colony-forming-units (cfu) will develop on agar plates in the presences of O2. Assume 1 bacterium creates one cfu.
    1. Match each product type to (1) the maximum number of cfu in a satisfactory (safe) serving and (2) the minimum number of cfu in an unsatisfactory (unsafe) serving:

(1) Satisfactory (safe) serving

Product

(2) Unsatisfactory serving

107 cfu

Confectionaries

6 x 107 cfu

7.5 x 104 cfu

Cooked meats

1010 cfu

6 x 105 cfu

Sandwiches & Salads

7.5 x 106 cfu

    1. How many grams of satisfactory cooked meats would be required to yield as many bacteria as are in 1 gram of soil?
      1. 2.5 grams ii. 25 grams iii. 250 grams iv. 2500 grams

LAB 4.2: Exam 1

Lab Exam 1 is scheduled to take place during this session.

LAB 5.1: DNA Fingerprinting – Paternity Test

Background

If you examine several DNA samples, you should be able to determine whether they come from just one person, from different people, or from related people. But WHY ?

Every person’s genome (their complete set of genetic material) is unique. In other words, no two people (except for identical twins) have the exact same DNA sequences in the exact same places on their chromosomes. However, because we inherit our chromosomes from our parents, half of our DNA should be the same as our mother’s and half should be the same as our father’s.

Because individual DNA molecules are impossible to see, we can use various methods, including a technique called “DNA fingerprinting”, to compare DNA samples. By identifying similarities and differences in the DNA sequences, we can determine who the samples came from.

DNA Fingerprinting

This process uses chemicals called restriction enzymes to cut DNA samples into fragments (pieces). Restriction enzymes bind to specific locations on the DNA, called recognition sites, and cut the DNA at those locations.

Because each person has different DNA sequences, they have recognition sites at different locations. Therefore, if we use the same restriction enzyme to cut the DNA of different people, we get DNA fragments of different lengths. These different sized fragments are called restriction fragment length polymorphisms (RFLPs).

No two people have the same exact pattern of RFLPs (except identical twins). To see patterns of RFLPs (i.e. get DNA fingerprints), we run DNA samples through a gel.

DNA Fingerprinting for Paternity Testing

We inherit our DNA from our parents – half our chromosomes are identical to chromosomes our mothers have, and half are identical to chromosomes our fathers have. Therefore, a person should share half their restriction fragments with their mother and half with their father. When we examine a child’s restriction fragments (seen as bands in the DNA fingerprint), bands that are not the same as the mother’s must have come from the father.

Lab Experiment (summary)

In this lab, we examine DNA samples from a mother, her child, and two people who might be the father. There is also a standard sample (“ladder”) that includes DNA fragments of all possible lengths. One restriction enzyme was used to cut the DNA sequences of all four people.

Your objective: run the DNA samples through a gel electrophoresis process and analyze the resulting DNA fragment patterns to determine which of the possible fathers is the biological parent.

INSTRUCTIONS (Write both the instructions and your results in your laboratory notebook as you perform this experiment.)

Follow each instruction carefully. See handout for more details and clarification.

  1. Make the gel:
    1. Combine agarose and buffer into one flask.
    2. Heat the mixture in microwave for one minute (1 ½ mins if two flasks together)
    3. Use the glove to remove the flasks.
  2. Let gel cool:
    1. Place thermometer in flask and wait for the solution to cool to 55 °C.
    2. IMPORTANT: Make sure the flask does not tip over by the weight of the thermometer.
  3. Pour gel into a gel bed with a comb in the slot at the edge of the gel.
    1. Check with your instructor to make sure comb is in the correct position.
    2. Allow gel to harden (about 20 minutes)
  4. Practice loading DNA into wells:
    1. Get a pre-made gel and a tube of dye from your instructor.
    2. Add water to the gel so that the wells are covered.
    3. Practice loading dye into wells using a pipette.
  5. After gel hardens, remove the comb from the gel.
    1. Notice the holes left in the gel (these are called wells).
    2. Later, you will load DNA samples into these wells.
  6. Remove the rubber dams from the gel.
  7. Place the gel into the electrophoresis chamber:
    1. IMPORTANT: Orient the gel so the wells are toward the negative side (black cord).
  8. Get packet of DNA samples from your instructor.
    1. Line your samples (A-E) up with your wells (see diagram)
  9. Load samples into wells:
    1. Take 20 microliters from sample A and carefully load it into the first well
    2. IMPORTANT: Use a new pipette tip for each DNA sample
    3. Repeat until you have loaded all samples A-E
  10. Cover the electrophoresis chamber. Be sure the electrode terminals are secure and correctly placed (red to red, black to black).
  11. Set power source to the higher value, if there’s a choice.
    1. Run electrophoresis for at least 30 minutes, 45 minutes if possible.
  12. Turn off power, unplug the electrophoresis chamber, and remove the cover.
  13. Transfer the gel onto plastic wrap on a flat surface (Be careful - the gel is slippery)
    1. Moisten the gel with a few drops of buffer

STOP! Your instructor will complete the following steps. STOP!

  1. Stain the gel:
    1. Wearing gloves, place unprinted side of the DNA InstaStain sheet on gel
    2. Run your fingers over entire surface of InstaStain several times.
    3. Place a gel casting tray and a small empty beaker on top of InstaStain
    4. Let it sit for about two minutes.
  2. Observe your results:
    1. Remove InstaStain sheet and transfer the gel to an ultraviolet transilluminator.
    2. WEAR PROTECTIVE GOGGLES to view the gel.

DISPOSAL & CLEAN-UP: stain sheet and plastic cover go in orange biohazard bags.

This is how your gel should be loaded (see instructions #7, 10, & 11, above). The letters (A-E) are located on top of the wells in your gel. If a mistake is made, be sure to edit the diagram to indicate what you actually did.

DNA source

DNA ladder

Mother

Child

Potential Father 1

Potential Father 2

Cap color

Red

White

Blue

Green

Yellow

Black wire

A

B

C

D

E

Red wire

Suggested Study Questions:

  1. What is a DNA fingerprint? Why are DNA fingerprints important in forensics?
  2. What is PCR? How is it related to DNA fingerprinting?
  3. What is a restriction enzyme?
  4. Explain the relationship between restriction enzymes and restriction fragments.
  5. What does gel electrophoresis do?
  6. Why do different individuals have different restriction enzyme recognition sites?
  7. What is the function of probes in DNA paternity analysis?

Practice Gels – Forensics

04a

Case #1

After an assault, a woman provides a tissue sample (vaginal swab) that includes both her DNA and the DNA of the man who attacked her.

Based on these DNA fingerprints, can this defendant be excluded?

07a

Case #2

After an assault, a woman provides a tissue sample (vaginal swab) that includes both her DNA and the DNA of the man who attacked her.

Based on these DNA fingerprints, can either suspect be excluded?

Practice Gels – Paternity Testing

02

Case #3

Based on these DNA fingerprints, are any of the four children NOT related to the male?

03a

Case #4

These DNA fingerprints belong to four children and their biological father.

Which column (1-5) is the father?

Which bands (A-D) come from the mother?

LAB 5.2: DNA – Protein Synthesis

In-Class Activities: Use your laboratory notebook to make drawings and answer questions

Protein synthesis review questions

  1. What are the three parts of a DNA nucleotide?
  2. What holds two strands of DNA together?
  3. What is the structure of the DNA molecule called?
  4. How are DNA and RNA different from one another?
  5. How is a section of DNA transcribed into a strand of mRNA?
  6. How is mRNA translated into a protein?
  7. Why are genes longer than the mRNA that is translated?
  8. What are the various functions of a codon?

Quantitative Literacy Activity - DNA, RNA, & Protein

    1. Using the genetic code in the table, transcribe the following DNA sequence into the complementary mRNA & then translate the mRNA into a polypeptide. Remember that AUG is the START codon.

DNA: TACAATGCTCCCACAGGTCTCGACATT

mRNA: _____ _____ _____ _____ _____ _____ _____ _____ _____

Protein: ______________________________________

    1. Using the genetic code in the table, show the gene product for the following DNA sequence: ATACCCGGTATAACGCCTGCAAACT

mRNA:

Protein:

    1. Using the genetic code in the table, show the gene product for the following DNA sequence: CGTACTTACCGATCCCGGGGCAC
    2. If a DNA molecule has 15% thymine (T),
    3. What percentage of adenine (A) does it have? ________
    4. What is the percentage of cytosine & guanine combined? ________
    5. What is the percentage of cytosine (C) alone? ________
    6. If a DNA molecule has 20% guanine (G),
    7. What percentage of cytosine (C) does it have? ________
    8. What percentage of thymine (T) does it have? ________
    9. What percentage of adenine (A) does it have? ________
    10. If a DNA molecule has 40% adenine (A), what percentage of cytosine (C) does it have?
    11. The DNA in human nongametic cells contains 6 billion base pairs. It is estimated that about 10,000 DNA changes occur in each cell in one day. These are quickly repaired so that only a few (1 to 5) mutations accumulate in one cell in a year.
      1. What percentage of base pairs are altered each day?
        1. 1.67 x 10-4 change/day ii) 1.67 x 10-6 changes/day iii) 1.67 x 10-8 changes /day
      2. What percentage of DNA changes that occur in one cell in one year escape the proofreading and repair process?
    12. Chemicals in the environment can cause mutations. A rather low level of mutation is caused by 1,2-epoxybutane. The rate is 0.006 mutants generated per nmole. A higher level of mutation is caused by the chemical agent aflatoxin, a toxin produced by a fungus. It induces 7057 mutants per nmole. (Assume a linear relationship between quantity of toxin and number of mutations.)
      1. What quantity of epoxybutane would be required to equal the mutant-causing ability of 1 nmole of aflatoxin?
        1. 1.18 nmoles ii) 7057 nmoles iii) 1, 176, 167 nmoles
    13. Mutations occur in chloroplasts (cp) and mitochondrial (mt) DNA as well as in nuclear (nuc) DNA. Nuclear DNA point mutations rates are similar in plants and animals. The plant mtDNA rate is less than 1/3 of the cpDNA rate, which is ½ the nucDNA rate. Animal mtDNA mutates 5 times faster than nucDNA.
      1. How much faster or slower is the mutation rate of plant mtDNA compared to animal mtDNA?
        1. 30x slower ii) 6x slower iii) 5x slower iv) 6x faster v) 30x faster

LAB 6.1: Bacterial Transformation

Introduction:

Bacterial transformation allows for the introduction of genetically engineered or naturally occurring plasmids into bacterial cells. Through the transformation process the bacterial cells will have foreign DNA from these plasmids added to their DNA. This results in the transformed cells having a newly acquired genetic trait that is heritable.

IMPORTANT: This experiment uses antibiotics. If you are allergic to antibiotics like penicillin, ampicillin, kanamycin, or tetracycline, you should NOT handle the materials in this experiment.

Objectives Checklist:

    • Describe the biological process of bacterial transformation by plasmid DNA.
    • Plate bacterial cells from a cell suspension on an agar plate.
    • Predict the results (which colonies will grow and what traits those colonies will exhibit) from a bacterial transformation experiment.
    • Interpret the agar plates from a bacterial transformation experiment and determine which plates have the control cells and which plates have the recombinant cells.
    • Calculate bacterial transformation efficiency.

In this lab we will induce E. coli bacteria to take up a pGAL plasmid (see figure below) from the environment. This plasmid will introduce two genes into the E. coli. The first gene is called beta galactosidase. This gene enables E. coli to cleave a specific molecule, which turns the cells blue. The second gene is called beta lactamase. This gene produces an enzyme that inactivates the antibiotic ampicillin. E. coli does not have this gene naturally and so is not naturally resistant to ampicillin. E. coli that have been transformed will have the beta lactamase gene. This causes them to produce an enzyme that will diffuse into agar around them and will inactivate any ampicillin antibiotic around those bacteria.

From Edvotek, Instructions from Edvo-Kit #221: Transformation of E. coli with pGal

At right, draw the expected results for each treatment:

Instructions (Write both the instructions & the results in your laboratory notebook):

  1. Please follow all instructions carefully. If you need clarification, your handout provides a helpful summary beginning on page 8, or use the figure above.
  2. Get two tubes and label them with your initials and: tube #1: ”+DNA”, tube #2: “–DNA.”
  3. Transfer 500 uL of CaCl2 solution into the “–DNA.”
  4. Using a toothpick, with a loop transfer about 15 colonies from the E. coli source plate into the “–DNA” tube. Twist the loop in the solution to free the colonies, then cap the tube. Shake the tube to re-suspend the cells.
  5. Transfer 250 uL of the solution from the “–DNA” tube to the tube labeled “+DNA.” They should have equal amounts. Place both tubes on ice.
  6. Put 10 uL of pGal into the tube labeled “+DNA.” Add 10 uL of control buffer to the tube labeled “–DNA.” Pipet tips should be disposed of in the orange biohazard bags.
  7. Put the cells on ice for 10 minutes.
  8. Place the cells in the 42 degree C heat block for 90 seconds.
  9. Placed the tubes back on ice for 2 minutes.
  10. Add 250 uL of the recovery broth to each of the two tubes.
  11. Incubate the two tubes in 37 degree C water bath for 30 minutes.
  12. Each group should take three agar plates and label them with their name & – 1. Control 1 (this has X-GAL without Ampicillin), 2. Control 2 (X-GAL with Ampicillin), 3. DNA (X-GAL with Ampicillin).
  13. Put 0.25 ml of control cells on both control agars. Put 0.25 ml of DNA on DNA agar.
  14. Spread the cells on the agar using the inoculating loop (see the figure in your lab manual for a demonstration). Pipet tips and inoculating loops should be disposed of in the orange biohazard bags.
  15. Stack plates on top of one another and tape them together. Label them with your name and turn them in to your professor.
  16. Wait 48 hours, then count the colonies on each of the plates. Record your counts in Table 15A.

Table 15A: Number of Colonies on each Plate.

Treatment

Plate Media

Number of Colonies at 48 Hours

Control

X-Gal

Control

X-Gal Amp

DNA (pGal)

X-Gal Amp

Explain the meaning of the results above. Are these the results that you expected? Why or why not?

Suggested Study Questions:

        1. What is a plasmid?
        2. What is recombinant DNA?
        3. What is a recombinant organism? What is a genetically modified organism? What is a transgenic organism?
        4. What is transformation?
        5. How does a bacterial colony form?
        6. A bacterial colony starts with how many cells?
        7. What does an antibiotic do?
        8. Define competency (for bacterial cells).
        9. Did you observe any satellite colonies? Why are they white? Why are they able to grow?
        10. Why did the competent cells which did not receive DNA (control) fail to grow on the plates containing ampicillin?
        11. Why are there so many cells growing on the “X-GAL” plate? What color are they? Why?
        12. The antibiotics, kanamycin and tetracycline, interfere with translation by binding to the ribosomes. Competent E. coli cells can be transformed with plasmids encoding resistance to these drugs. When the cells are plated on agar media containing kanamycin or tetracycline, satellite colonies are not found. Increasing incubation times and the amount of cells plated do not give rise to satellites in the case. Why?
        13. Why are there more cells growing on the “X-GAL” plate than the pGAL recombinant plate?

Quantitative Literacy Activity: Bacterial Transformation Efficiency

Not all of the cells that were exposed to the conditions required for competency actually survived and incorporated DNA from their environment. This means that only a portion of the original cells in the DNA treatment transformed. Bacterial Transformation Efficiency is the number of cells that were transformed per 1 µg of plasmid DNA.

It is possible to calculate the number of transformants based on your incubated plates? The formula is:

Number of Transformants per µg =

Number of Transformants

X

Final volume at Recovery (ml)

µg of DNA

Volume plated (ml)

The table below gives the variables required to calculate the Bacterial Transformation Efficiency for this experiment.

  1. Enter the number of transformants that you counted on your plate.
  2. For each variable, enter the step or steps in the protocol in which the amount given is found.
  3. Double check that you agree with the amount in the table for each variable. Remember that 1 ml = 1000 µl

Variable

Amount

Step in protocol in which the amount is given (or recorded)

µg of DNA

0.025 µg

The protocol does not give you this amount - it is calculated from the set up done before the lab.

Final volume at Recovery (ml)

0.3 ml + 0.75 ml + 25 µl = 1.075 ml

Volume plated (ml)

0.25 ml

Number of Transformants

Using the information in the table above, calculate the bacterial transformation efficiency for your plate. SHOW YOUR CALCULATIONS.

LABS 6.2 & 7.1: The Protista – The Protozoans and The Algae

Introduction: Many protists are “taxonomic misfits” that create problems for those attempting to classify them. The protists are eukaryotes whose cells have a nucleus and all the various organelles. They are not plants, animals, or fungi. Rather than sharing taxonomic similarities they have been assigned to the Protista because they do not fit into any of the other three eukaryote kingdoms. Most are unicellular but some are multicellular. Most are microscopic but some are 50 meters in length. Some are fungus-like (the water and slime molds), some are plant-like (the algae), and still others are animal-like (the protozoans). Organisms classified as protists were the first eukaryotes on the planet; all other eukaryotes are descended from protist ancestors.

Purpose: To be introduced to the diversity of eukaryotic organisms, differentiate among the various groups of protists, and identify and study the characteristics of different protozoan and algal organisms classified as protists.

Slides:

Domain

Supergroup

(unranked)

Phylum

Slide #

Organism

Description

Eukarya

Chromalveolata

(in SAR)

Alveolata

Ciliophora

15

Paramecium

Cells performing conjugation

Eukarya

Amoebozoa Unikonta

Amoebozoa

16

Amoeba proteus

Cells

Eukarya

Chromalveolata

(in SAR)

Alveolata

Apicomplexa

201

Plasmodium

Cells infecting human blood

Eukarya

Excavata

Euglenozoa

202

Trypanosoma

Cells infecting human blood

Eukarya

Excavata

Euglenozoa

204

Euglena

Cells

Eukarya

Archaeplastida

Green Algae

39

Spirogyra

Filamentous colonies performing conjugation

Eukarya

Archaeplastida

Green Algae

41

Volvox

Colonies and daughter colonies

Eukarya

Archaeplastida

Green Algae

42

Spirogyra

Filamentous colonies

Eukarya

Chromalveolata

(in SAR)

Stramenopila

Brown Algae

44

Fucus

Thallus – dioecious comb.

Eukarya

Chromalveolata

(in SAR)

Stramenopila

Brown Algae

44

Fucus

Thallus – monoecious

Eukarya

Archaeplastida

Red Algae

46

Polysiphonia

Thallus

Eukarya

Chromalveolata

(in SAR)

Stramenopila

Chrysophyta

36

Various Desmids

Eukarya

Archaeplastida

Green Algae

221

Oedogonium

Eukarya

Archaeplastida

Green Algae

40

Ulothrix

Eukarya

Chromalveolata

(in SAR)

Stramenopila

Chrysophyta

43

Various Diatoms

Live Cultures/Specimens: Euglena, Paramecium, Amoeba, Spirogyra, Volvox, Fucus, Polysiphonia

Objectives Checklist:

  • Identify the characteristics of the organisms that are classified as protists.
  • Identify the characteristics of the organisms that belong to the 4 supergroups: SAR, Excavata, Unikonta, and Archaeplastida.
  • Identify the characteristics of the organisms that belong to the brown algae, red algae, and green algae (including life cycles, asexual and sexual).
  • Identify the characteristics of the organisms that we use as examples below (including life cycles, asexual and sexual).
  • Explain the 3 major life cycles: haplontic, diplontic, and alternation of generations. Identify the life cycles of the following organisms: Paramecium, Spirogyra
  • Define the following terms: diversity, unicellular, colonial, multicellular, conjugation
  • Identify and state the function of the following parts of genus Amoeba: Plasma membrane, Cytoplasm (ectoplasm and endoplasm), Nucleus, Contractile vacuole, Food vacuole, Pseudopods
  • Identify and state the function of the following parts of the genus Paramecium: Plasma membrane, Pellicle, Trichocyst, Macronucleus and micronucleus, Contractile vacuole, Gullet, Oral groove, Anal pore
  • Identify and state the function of the following parts of the genus Trypanosoma: Plasma membrane, Cytoplasm, Nucleus, Flagellum
  • Explain the following modes of acquiring nutrition and energy: heterotrophy, autotrophy, mixotrophy
  • Explain the various types of symbiosis: mutualism, commensalism, and parasitism. Define the following terms: host, vector, parasite, endosymbiosis. Explain the characteristics of the life cycle of the malaria-causing organism Plasmodium, including the host and vector.
  • Identify the characteristics of the organisms that belong to the Phylum Euglenophyta.
  • Identify and state the function of the following parts of the genus Euglena: Plasma membrane, Flagellum, Cytoplasm, Eye spot (stigma), Nucleus
  • Identify and state the function of the following parts of the genus Volvox: Colony, Daughter colony, Flagella
  • Identify and state the function of the following parts of the genus Spirogyra: Cell wall, Cytoplasm, Nucleus, Chloroplast, Pyrenoid, Conjugation tube, Zygote
  • Identify and state the function of the following parts of the genus Fucus: Thallus, holdfast, Air bladder, Conceptacles, Antheridium (with sperm), Oogonium (with eggs)
  • Identify the organism Polysiphonia: Antheridium, Carpogonium, Tetrasporophyte

Pre-Lab: The student should read the following pages in the course materials & study guide and the appropriate pages in the text and in the lab manual (see the Lab Syllabus). Describe the function of each of the vocabulary terms in the objectives list above. Make sure to note which of the protists examples each particular structure can be found in.

In-class activities (Use your laboratory notebook to make drawings and answer questions):

  1. Look at each of the slides under the microscope. Draw the visible structures and label the visible parts.
  2. Look at each of the provided models. Draw the visible structures and label the parts.
  3. Look at each of the live specimens, making wet mount slides as needed. Draw the visible structures and label the parts.

Study Suggestions:

  1. Show the relationships among the 4 supergroups and where the animals, plants, and fungi fit on the phylogeny. For each supergroup and kingdom, list 2 important characteristics & 1 example organism.
  2. What are the differences between haplontic, diplontic, and alternation of generations life cycles?
  3. You are trying to determine in which supergroup, kingdom, or phylum to place a newly discovered single-celled eukaryotic organism. Identify at least three characteristics that you would use to classify your discovery.
  4. What is parasitism? How are the host and the vector organism important in a parasite’s life cycle?
  5. How is endosymbiosis relevant to the evolution of eukaryotes?
  6. What is the difference between a unicellular organism, a colonial organism, and a multicellular organism?
  7. Explain the difference between heterotrophy, autotrophy, and mixotrophy.
  8. Differentiate between a protozoan and an alga.
  9. You have found a new single-celled organism.
    1. What characteristics would you use to determine in which domain to classify this organism?
    2. What characteristics would you use to determine in which supergroup to classify this organism?
    3. What characteristics would you use to determine in which kingdom to classify this organism?

Quantitative Literacy Activity – Protists

Answer the following questions to the best of your ability. Show your work.

  1. Marine iguanas on two Galapagos islands eat algae at low tides. They were observed and their stomach contents flushed and dried and the caloric content determined. When average 550 gram iguanas were compared at these two sites, the following data were collected.

Site A

Site B

Feeding time (min/day)

23.2

81.7

Dry mass eaten (g/day)

2.84

1.72

Number of bites/day

682

3041

Energy (kJ/g)

13.8

10

    1. Which site yielded more energy per day, and how many times more?
      1. Site A … 2.28x ii) Site A … 3.3x iii) Site B … 2.28x iv) Site B …3.3x
    2. Which site yielded more energy per bite, and how many times more?
      1. Site A …5.1x ii) Site A …10.2x iii) Site B …5.1x iv) Site B …10.2x
    3. Which site yielded more energy per time, and how many times more?
      1. Site A …8.01x ii) Site A …16.02x iii) Site B …8.01x iv) Site B …16.02x
  1. World ecosystem net primary productivity is estimated to be 162.4 x 109 metric tons (t) per year. About two-thirds of this productivity is land and freshwater based, and the other third is marine based (continental shelf and open ocean). [1 metric ton is equal to 106 g.]

The tropical rain forest area is 1.7 x 106 square kilometers (km), and it accounts for about one-third of land-based productivity. The open ocean area is 332 x106 square kilometers and its rate of production is 127 grams per square meter per year.

    1. What is the productivity of tropical rain forest in grams per square meter per year?
      1. 36.1 g/m2/yr ii) 127 g/m2/yr iii) 162.4 g/m2/yr iv) 2120 g/m2/yr
    2. How much of the marine productivity comes from open ocean?
      1. 33% ii) 52% iii) 78% iv) 100%
    3. How many times more productive is the tropical rain forest than the open ocean?
      1. 7 times ii) 10 times iii) 17 times iv) 20 times
  1. Answer the following using the tentative phylogeny of the Eukaryotes in chapter 16 of your textbook.
    1. Most eukaryotic organisms belong to which kingdom?
      1. Animalia
      2. Plantae
      3. Fungi
      4. Protista
    2. Which groups have you studied in the past two labs?
    3. Which of the following groups is the most closely related to land plants?
      1. Stramenopiles
      2. Red algae
      3. Green algae
      4. Amoebozoans
    4. Which of the following groups is the most closely related to animals?
      1. Ciliates
      2. Amoebozoans
      3. Fungi
      4. Excavata
    5. Explain why animals are NOT considered to have evolved from fungi.
    6. Why aren’t Domains Bacteria and Archaea represented on this phylogeny?
    7. Why are protists particularly important to biologists investigating the evolution of eukaryotic life?

LAB 7.2: Exam 2

Your second exam will take place at the next meeting.

LAB 8.1: Kingdom Fungi

Introduction: If one looks at a mushroom growing out of the ground and is asked to classify it as a plant or animal one might instinctively say “plant.” Because of their cell walls fungi were once considered to be plants. However, fungal cells are quite different from plant cells. They lack chloroplasts and their cell walls contain chitin instead of cellulose. Chitin is the same material that makes up the external skeleton of insects.

The roles of fungi and plants differ greatly. Fungi obtain their nutrients by breaking down the bodies of dead and, sometimes, living organisms. Like animals they are heterotrophic, but like bacteria the cell walls of fungi prevent them from ingesting food. Thus, they must release enzymes outside their bodies to digest food.

Purpose: To identify and study the characteristics of representatives of the Kingdom Fungi.

Objectives Checklist:

  • Identify the characteristics of organisms belonging to the Kingdom Fungi.
  • Identify the characteristics of organisms belonging to the Division Zygomycota.
  • Identify and state the function of the following parts of the genus Rhizopus: Sporangium, Spores, (Horizontal) Hyphae, Rhizoids, Mycelium, Zygote
  • Identify the characteristics of organisms belonging to the Division Ascomycota.
  • Identify and state the function of the following part of the genus Penicillium: Conidia
  • Identify the characteristics of organisms belonging to the Division Basidiomycota.
  • Identify and state the function of the following parts of the genus Coprinus: Gill cap, Gill, Basidium, Basidiospores
  • Identify and state the function of the following parts of a mushroom: Cap, Gills, Stalk, Annulus
  • Identify and state the function of the following parts of a lichen: Cyanobacterium or Green Alga, Ascomycete. Explain the ecological niche of lichens.
  • Define mycorrhizae – state the two kingdoms involved: Plantae, Fungi. Explain the ecological niche of mycorrhizae.

Slides:

Slide

Kingdom (s)

Fungal Division

Genus

Description

#49

Fungi

Zygomycota

Rhizopus

Sporangia (produce asexual spores)

#50

Fungi

Zygomycota

Rhizopus

Conjugation (a process in sexual reproduction)

#52

Fungi

Ascomycota

Penicillium and Aspergillus

some also contain Rhizopus

#56

Fungi

Basidiomycota

Coprinus

Cross section

#53

Fungi

Ascomycota

Peziza

Cross section showing asci

#54

Fungi

Ascomycota

Claviceps

Claviceps purpura - ergot of rye

#59

Fungi & Protista

Physica Lichen

The thallus of a lichen

Pre-Lab: The student should read the following pages in the course materials & study guide and the appropriate pages in the text and in the lab manual (see the Lab Syllabus). Provide a definition for each structure and explain the function of each of the vocabulary terms in the objectives list above. Make sure to note in which specimen the structure is found.

In-Class Activities (Use your laboratory notebook to make drawings and answer questions):

  1. Look at each of the slides under the microscope. Draw the visible structures and label the visible parts.
  2. Look at each of the provided models. Draw the visible structures and label the parts.
  3. Look at each of the live specimens, making wet mount slides as needed. Draw the visible structures and label the parts.
  4. For the following taxa: ascomycetes, basidiomycetes, zygomycetes, deuteromycetes, glomeromycetes, land plants, green algae, and cyanobacteria, explain what each biological group contains. Include the factors that define that group & differentiates it from other groups. Note which of the organisms that we studied fit in each of these fungal divisions or larger biological classifications.

Suggested Study Questions:

        1. What is the mycelium?
        2. What is a symbiosis?
        3. Describe the structure of lichens and explain their importance.
        4. What are mycorrhizae? Describe the structure of mycorrhizae & explain their importance.
        5. Explain the fungal life cycle. Draw a diagram as part of your explanation. How does the fungal life cycle differ from life the haplontic, diplontic, and alternation of generations life cycles that we studied in Kingdom Protista?
        6. How do fungi obtain their nutrition? How is this different from plants & animals?
        7. When hiking you come across a previously unknown fungus. In the space below list the ways that you would determine in which division to place the new fungus.
        8. Differentiate among the life cycles of Zycomycota, Ascomycota, Basidiomycota, and Deuteromycota (using a table like the one below)

Division Ascomycota

Division Basidiomycota

Division Deuteromycota

Division Zygomycota

Common name

Example organism(s)

Type of hyphae

Common mode of reproduction (sexual or asexual?)

Name of sexually produced spores (if present)

Name of structure that produces spores sexually (if present)

Name of asexually produced spores (if present)

Name of structure that produces spores asexually (if present)

Typical habitat

Typical source of nutrition

Quantitative Literacy Activity – Fungi

  1. The ancestors of fungi and animals are thought to have diverged about 1.5 billion years ago (based on molecular clock estimates), but the earliest fossilized fungi found so far are only about 460 million years old. Look at the phylogeny in chapter 15 of your textbook. The chytrids do not have a solid line because they are not thought to be monophyletic (describes a group descended from a single ancestral species that gave rise to no species in any other group, Campbell 6th ed.).
    1. Based on these suppositions, which of the following pairs of fungal groups are the most closely related?
      1. Chytrids and Zyogmycetes iv) Ascomycetes and Basidiomycetes
      2. Zygomycetes and Glomeromycetes v) Glomeromycetes and Ascomycetes
      3. Glomeromycetes and Basidiomycetes
    2. Which of the following fungal groups is most closely related to animals?
      1. Chytrids iii) ) Glomeromycetes v) Basiciomycetes
      2. Zygomycetes iv) Ascomycetes
    3. Name one characteristic that the most closely related fungal group has in common with animals. [HINT: It relates to reproduction.] How is this trait different in all of the other fungal groups?

LAB 8.2: Nonvascular and Seedless Vascular Plants

Introduction: It is likely that plants and green algae share a common ancestor. Both utilize chlorophyll a and b as well as carotenoids during photosynthesis. Starch, the primary food reserve, is found inside chloroplasts. Both form a cell plate during mitosis and have a cell wall which contains cellulose. However, unlike algae, plants live in a wide variety of terrestrial environments. Plants also protect their reproductive cells and the embryo within their bodies.

One phylum of nonvascular plants, the Bryophyta, and several divisions of vascular plants are included in the kingdom Plantae. Bryophytes are the most primitive terrestrial plants and include plants like mosses and liverworts. In all bryophytes, the sporophyte is dependent on the dominant gametophyte. Because they lack roots and conducting vessels, they hug the ground and grow close to a source of ground water. Bryophytes depend on water to allow their free swimming male gametes to fertilize female gametes.

Vascular plants contain vascular tissue: xylem, which conducts water and minerals up from the soil, and phloem, which transports organic nutrients. The presence of vascular tissue makes it possible for these plants to grow taller than bryophytes can. The vascular plants have true roots, stems, and leaves.

Some vascular plants do not produce seeds. Seedless vascular plants include club mosses, horse tails and ferns. The sporophyte is dominant and the species is dispersed by producing windblown spores. The independent gametophyte produces flagellated sperm.

Ferns have an economic value. They are used by florists in bouquets and as ornamental plants. Tropical tree ferns are used as wood because their wood resists decay and termites. Ferns also have a medicinal value.

Purpose: To identify and study the characteristics of the different representatives of the Non-vascular plants (e.g. bryophytes) and the Seedless Vascular plants.

Objectives Checklist:

  • Identify the characteristics of the organisms belonging to the Kingdom Plantae
  • Identify the characteristics of the organisms belonging to the Non-vascular Plants
  • Identify and state the function of the following parts of the genus Marchantia (Class Hepaticae): Gemma cups, Gametophyte, Antheridium (with sperm), Archegonium (with egg), Sporophyte, Spores, Elaters
  • Identify and state the function of the following parts of the genus Polytrichium (Class Musci): Gametophyte, Antheridium (with sperm), Archegonium (with egg), Sporophyte, Spores, Operculum (lid)
  • Describe the life cycle of a moss.
  • Identify the characteristics of the organisms belonging to the Seedless Vascular Plants
  • Identify and state the function of the following parts of a fern plant: Frond with leaflets, Rhizome, Vascular bundle (xylem and phloem), Gametophyte, Prothallus, Rhizoids, Antheridium (with sperm), Archegonium (with egg), Sporophyte, Sorus with indusium, Sporangium with spores
  • Describe the life cycle of fern.
  • Compare and contrast a non-vascular plant and a seedless vascular plant

Slides: (all in Kingdom Plantae, Domain Eukarya)

Group 1

Group 2

#

Genus of specimen

Part

Nonvascular Plants

Liverworts

60

Marchantia

Cupule

Nonvascular Plants

Liverworts

61

Marchantia

Antheridia

Nonvascular Plants

Liverworts

62

Marchantia

Archegonia

Nonvascular Plants

Liverworts

63

Marchantia

Sporophyte

Nonvascular Plants

Mosses

64

Polytrichum

Antheridia & paraphysis

Nonvascular Plants

Mosses

65

Polytrichum

Capsule

Nonvascular Plants

Mosses

66

Sphagnum

Gametophyte proteonema

Seedless Vascular Plants

Ferns

67

Fern

Prothallia

Seedless Vascular Plants

Ferns

68

Generic fern

Embryo

Seedless vascular plants

Leptosporangiate ferns

69

Polypodium

Leaflet

Seedless Vascular Plants

Leptosporangiate ferns

70

Polypodium

Rhizome

Seedless vascular plants

Lycophytes (club or spike mosses)

71

Selaginella strobius

Pre-Lab: The student should read the following pages in the course materials & study guide and the appropriate pages in the text and in the lab manual (see the Lab Syllabus). Provide a definition for each structure and explain the function of each of the vocabulary terms (in bold text) in the objectives list above. Make sure to note in which specimen the structure is found. Indicate whether the structure is found on the gametophyte or the sporophyte.

In-class activities (Use your laboratory notebook to make drawings and answer questions):

  1. Look at each of the slides under the microscope. Draw the visible structures and label the visible parts.
  2. Look at each of the provided models. Draw the visible structures and label the parts.
  3. Look at each of the live specimens, making wet mount slides as needed. Draw the visible structures and label the parts.

Study Questions:

  1. In what ways has the non-vascular plant failed to fully adapt to the dry terrestrial environment?
  2. In some forests of the northern hemisphere, mosses tend to grow on the north-facing surface of the bark. Why do these mosses not grow as well on the southern faces of these trees?
  3. Why should the absence of vascular tissue affect the size to which a plant can grow?
  4. In what way are ferns not fully adapted to a dry terrestrial environment?

Quantitative Literacy Activity – Bryophytes & Ferns

  1. Draw a phylogeny showing the consensus view on the evolutionary history plants. You may wish to refer to Figure 17.2A in Campbell for help in answering the questions below.
  2. What are the key terrestrial adaptations associated with branches on the phylogeny? (In other words, which key adaptations separate the major groups of plants? Map those on your phylogeny).

LAB 9.1: The Gymnosperms

Introduction: Gymnosperms and angioperms are plants that produce seeds. A seed has a protective seed coat which encloses an embryo and stored food. It is well adapted to survival on land. The seeds produced by gymnosperms are "naked" and are found on the surface of scales within cones, while the seeds of angiosperms, the flowering plants, are covered by a fruit.

The largest group of gymnosperms is the conifers (Phylum Coniferophyta), which include the cone-bearing pine, spruce, fir, and redwood trees. These evergreen trees have needle-like leaves which are adapted to hot summers and cold winters. Male cones produce pollen grains which do not require water to fertilize ovules, which are located on seed cone scales. The pollen is wind-dispersed.

Conifers are found on large portions of the earth's surface and provide much of the wood used in construction. The oldest and largest trees in the world are conifers. Some bristlecone pines, which are found in California and Nevada, are over 4,600 years old and a number of redwood trees in California are over 2,000 years old and reach a height of almost 300 feet.

Purpose: The purpose of this lab is to identify and study the characteristics of different representatives of the gymnosperms.

Objectives Checklist:

  • Identify the characteristics of the organisms belonging to the Phylum Coniferophyta (in the Gymnosperms)
  • Identify and state the function of the following parts of pine leaf (needle): Vascular bundle (xylem and phloem), Mesophyll, Resin sacs
  • Identify and state the function of the following parts of a staminate (male) cone: Microsporangium, Pollen grains (with wings)
  • Identify and state the function of the following parts of an ovulate (female) cone: Scale, Megaspore
  • Describe the life cycle of a pine.
  • Compare and contrast a fern and a pine.

Slides: (all in Kingdom Plantae)

Group 1

Group 2

Division

#

Genus

Specimen

Vascular Seed Plants

Gymnosperms

Coniferophyta

74

Pinus

Pine stem (several years)

Vascular Seed Plants

Gymnosperms

Coniferophyta

75

Pinus

Pine 5 needle

Vascular Seed Plants

Gymnosperms

Coniferophyta

76

Pinus

Pine staminate cone

Vascular Seed Plants

Gymnosperms

Coniferophyta

77

Pinus

Pine female cone

Vascular Seed Plants

Gymnosperms

Coniferophyta

78

Pinus

Pine mature pollen

Vascular Seed Plants

Gymnosperms

Cycadophyta

79

Zamia

Zamia archegonia (ovule)

Pre-Lab: The student should read the following pages in the course materials & study guide and the appropriate pages in the text and in the lab manual (see the Lab Syllabus). Provide a definition for each structure and explain the function of each of the vocabulary terms (in bold text) in the objectives list above. Make sure to note in which plant organ and specimen the structure is found. Indicate whether the structure is found on the gametophyte or the sporophyte and in which part of the life cycle the structure is found.

In-Class Activities (Use your laboratory notebook to make drawings and answer questions):

  1. Look at each of the slides under the microscope. Draw the visible structures and label the visible parts.
  2. Look at each of the provided models. Draw the visible structures and label the parts.
  3. Look at each of the live specimens, making wet mount slides as needed. Draw the visible structures and label the parts.

Study Questions:

  1. Pollen cones remain on a tree for only 1 to 2 months, seed cones for as long as 3 years. Why do you think that is?
  2. In what ways is the life cycle of a fern more similar than a bryophyte’s life cycle to that of a gymnosperm?
  3. How has the evolution of seeds and pollen grains contributed to the success of conifers in a terrestrial environment?
  4. According to a news report about a newly discovered plant, the dominant stage in the plant’s life cycle releases spores that develop into a barely visible form of the plant. This stage in turn produces swimming sperm and non-motile eggs. The reporter was surprised that the plant did not produce pollen or seeds. Without more information you can reasonably hypothesize that the dominant stage and the smaller stage are:

a) the gametophyte and sporophyte of a moss

b) the diploid and haploid stages of a fern

c) both haploid and lack vascular tissue

d) both diploid and have vascular tissue

To which group of plants does the newly discovered plant belong?

Plant Review Table

Use a table based on this one to create a review of the plant groups.

Plant Group:

Nonvascular

Seedless Vascular

Seed Plants

Gymnosperms

Angiosperms

Key new adaptations

Dominant life stage

How are male gametes dispersed?

Are spores dispersed? If yes, how?

Are seeds are present? If yes, how are they dispersed?

Habitat restrictions

Example organisms

Distinguishing characteristics

LABS 9.2 & 10.1: Plant Development

Purpose: To identify and study the parts of flowers, fruits and seeds.

Introduction: The most advanced examples of plants today are members of the Phlyum Magnoliaphyta (the Angiosperms or flowering plants). The life cycle of such plants is characterized by an alternation of generations. The dependent gametophyte generation is haploid and produces gametes, which fuse during sexual reproduction. The dominant sporophyte generation, which results from sexual reproduction, is diploid and reproduces asexually after the plant undergoes meiosis to produce spores. A mature angiosperm usually possesses many flowers composed of many parts. While several parts of the flower are involved in attracting insects for pollination, others are involved in producing seeds. During development in angiosperms, the seed is surrounded by protective fruit.

Objectives Checklist (lab 9.2):

  • Identify the characteristics of the organisms belonging to the Angiosperms.
  • Identify and state the function of the following parts of the flower: Sepals, Petals, Pistil, Stigma, Style, Ovary, Ovule, Stamen, Anther, Filament, Microgametophyte (Pollen grains), Pollen tubes, Sperm nuclei
  • Describe the life cycle of an angiosperm. Understand what makes the alternation of generations life cycle different from the haplontic and diplontic life cycles.
  • Describe the differences between monocot and dicot flowers.
  • Be able to distinguish between pollination and fertilization.
  • Understand how co-evolution between many animals and angiosperms contributed to the success of both groups.

Objectives Checklist (lab 10.1):

  • Identify and state the function of the following parts of a dicot seed (genus Capsella): Seed coat, Cotyledons, Epicotyl, Hypocotyl, Radicle
  • Identify and state the function of the following parts of a monocot seed (genus Zea): Seed coat, Cotyledon, Plumule, Epicotyl, Hypocotyl, Radicle, Endosperm
  • Identify the various types of fruit: Simple, Compound, Aggregate, Multiple, Fleshy, Dry. Identify any additional types of fruit and provide examples, as requested by your instructor.
  • Distinguish between pollination and fertilization.
  • Describe the differences between monocot & dicot seeds.

Slides:

Kingdom

Group 1

Group 2

Genus

Slide

Description

Plantae

Vascular Seed Plant

Angiosperms

Lilium

85

Monocot flower bud - Can see sepals, petals, anther, & pistil from above

Plantae

Vascular Seed Plant

Angiosperms

Lilium

86

Anther – late prophase

Plantae

Vascular Seed Plant

Angiosperms

Lilium

87

Anther – tetrad

Plantae

Vascular Seed Plant

Angiosperms

Lilium

88

Anther – mature pollen

Plantae

Vascular Seed Plant

Angiosperms

89

Pollen tubes

Plantae

Vascular Seed Plant

Angiosperms

Capsella

90

Dicot - Late embryo

Plantae

Vascular Seed Plant

Angiosperms

Capsella

91

Dicot - Mature embryo

Plantae

Vascular Seed Plant

Angiosperms

Zea mays

92

Monocot embryo

Pre-Lab: The student should read the following pages in the course materials & study guide and the appropriate pages in the text and in the lab manual (see the Lab Syllabus,). Provide a definition for each structure and explain the function of each of the vocabulary terms (in bold text) in the objectives list above. Make sure to note in which plant organ and specimen the structure is found. Indicate whether the structure is found on the gametophyte or the sporophyte and in which part of the life cycle the structure is found. Indicate whether the structure is found in dicots, monocots, or both.

In-Class Activities (Use your laboratory notebook to make drawings and answer questions):

  1. Look at each of the slides under the microscope. Draw the visible structures and label the visible parts.
  2. Look at each of the provided models. Draw the visible structures and label the parts.
  3. Look at each of the live specimens, making wet mount slides as needed. Draw the visible structures and label the parts.

Study Suggestions:

  1. Draw the angiosperm life cycle, labeling each of the stages. Make sure to note whether the stage is haploid or diploid.
  2. Explain the advantages AND disadvantages of cross pollination as opposed to self-pollination.
  3. Contrast monocot and dicot flowers and seeds. Use labeled diagrams to help illustrate your points.
  4. You find a new plant with parallel veins and six petals. Would you classify this plant as a monocot or dicot?
  5. How has co-evolution between some animals and angiosperms contributed to the success of both groups? What can animals do for angiosperms? What can angiosperms do for animals?
  6. Other than spreading the species to new areas (expanding the species range), what are the advantages for angiosperm seeds to be dispersed away from the parental plant?
  7. Explain how a wind-pollinated flower would be different from an animal-pollinated flower.
  8. Explain how a wind-dispersed seed would be different from an animal-dispersed seed. Give some examples of the variation in the animal-dispersed seeds (& their fruits) based on which animal is doing the dispersing.

LAB 10.2: Exam 3

LAB 11.1: Human Evolution and Adaptation

In-Class Activities: Use your laboratory notebook to make tables & drawings and answer questions.

Station 1 – Hominin evolution

Humans and all of their fossil relatives are grouped within the subfamily Homininae. All hominins walk bipedally. This is what differentiates the first hominin, the first early human species, from the apes, including chimpanzees and gorillas. Walking bipedally all the time requires that you change your anatomy in fundamental ways, ways that show up in the fossil record. In the first station you will fill out the worksheet provided by comparing and contrasting the Pan troglodytes, Australopithecus afarensis, Homo erectus and Homo sapiens skulls.

Use the answers on your worksheet to answer the following questions: 1) What features of the Australopithecus skull are used to group this genus with hominins and not with great apes? 2) Which feature evolved first: bipedalism or a large brain?

Station 2 – Adaptation

One of mechanisms by which evolution occurs is natural selection in which individuals who have beneficial characteristics in a particular environment are more likely to survive and pass their DNA on to the next generation. This process leads a population to adapt to a particular environment, so that it is better able to survive.

A. Paranthropus diet

The species within the genus Paranthropus used to be called robust australopithecines because of the robusticity (or relative thickness) of their skulls. This bulkiness is due to the need for attachment sites for the large chewing muscles attaching to the cranium and mandible. This is not due to meat eating as many people suspect. Paranthropus was, instead, adapted to eating a more fibrous and tougher diet. They mostly ate food items like nuts, hard fruits and tubers.

  1. Fill in the worksheet provided by comparing and contrasting the Pan troglodytes, Australopithecus afarensis, Paranthropus boisei and Homo sapiens skulls.
  2. For the size of the molars, use the calipers provided to measure the length and breadth of the first molar on the mandible and then multiply length x breadth to determine whether the molars are small, medium or large.
  3. In the space provided, list the unique features of the Paranthropus skull and how they relate to its diet.

B. Neandertals and modern humans

Neandertals mostly lived in cold climates and many of the differences between Homo sapiens and Homo neanderthalensis are related to the cold environment in which neandertals lived. The body proportions of neandertals are similar to those of modern cold-adapted peoples: short and thick, with short limbs. Their bones show signs of powerful muscle attachments.

Despite their reputation, neandertals were culturally quite advanced. They were formidable hunters of big game and had sophisticated stone tools. They were also the first species that is known to have buried its dead.

What happened to neandertals is still open to debate. Most biological anthropologists think that they were out-competed by modern humans when we arrived in Europe and the Middle East. However, a minority of researchers think that neandertals evolved into today’s Europeans.

Examine the Neandertal and modern human skulls and fill out the worksheet provided. Answer the following questions based on your worksheet at home.

  1. How are the Neandertal and modern human skulls different?
  2. Which of these features are likely to be related to a cold adaptation in Neandertals and why?

Station 3 – Forensics and sexual dimorphism

Modern humans exhibit a reduced degree of sexual dimorphism (the extent of difference between males and females) relative to their fossil ancestors. However, it is still possible in most cases to be able to tell apart male and female skeletons. Determining the sex of a skeleton is most easily done using the pelvis. There are also features on the skull that can be useful in determining sex.

Examine the modern human pelves and skulls and answer the following questions based on them using the guide provided.

  1. Which of the pelves is male and which is female? Why?
  2. Which of the skulls is most likely to be male and which is most likely to be female? Why?

To determine the gender based on primarily skeletal features:

Notes: It is important not to depend on any single skeletal feature when attempting to establish the victim’s gender from their skeletal remains. You should always observe as many of the features of the remains as possible to increase the probability of successfully establishing gender.

Sexual differences in cranial morphology:

  • General architecture: In males, the overall construction of the skull is heavier and more rugged looking than that of the female skull.
  • Brow ridges: The supraorbital ridge of males is heavier and more pronounced than it is in females; in females the brow is smooth and flat.
  • Cheekbones: The cheekbones of males are heavier and more laterally arched; in females, cheekbones are lighter, more compressed, and they tend to lack the lateral arching.
  • Occipital condyle and mastoid process: In males, the occipital condyle and mastoid process at the rear base of the skull tend to be much more pronounced than in females, where they can be almost nonexistent.
  • Chin shape: The shape of a male’s chin approximated a letter U, a females’ the letter V (square chin vs. round chin).
  • Jaw line: The angle where the horizontal portion of the jaw curves upward into the ramus, or vertical part of the jaw, is much more angular in males than it is in females. Also, males tend to have more muscle markings at this angle.

Sexual differences in pelvic morphology:

  • General architecture: The width of the pelvic girdle is broader in females than it is in males. In females, the pelvic girdle surrounds a birth canal large enough for a fetus to pass. In males, the pelvic opening is less round and open.
  • Pelvic opening: The opening of the pelvis, called the pelvic inlet, is rounder and larger in females, while in males it tends to be narrow and more constricted.
  • Pubic arch: The joining of the bones at the bottom of the pelvis forms a broad angle in females, usually greater than 90°, while in males it is narrow, usually less than 90°.

Study Questions – Human Evolution: Refer to Chapter 19 in your textbook for reference.

  1. How much longer ago did lemurs evolve than hominids (humans)?
    1. The same length of time b) 2 times c) 5 times d) 10 times e) 20 times
  2. How many millions of years ago (MYA) did the apes diverge from the Old World monkeys?
    1. 5 - 10 MYA b) 10 - 15MYA c) 20 - 25 MYA d) 30 - 35 MYA e) 50 - 55 MYA
  3. How many millions of years ago did the anthropoids diverge from other primates?
    1. 5 - 10 MYA b) 10 - 15MYA c) 20 - 25 MYA d) 30 - 35 MYA e) 50 - 55 MYA
  4. How many millions of years ago did the Old World monkeys diverge from the New World monkeys?
    1. 5 - 10 MYA b) 10 - 15MYA c) 20 - 25 MYA d) 30 - 35 MYA e) 50 - 55 MYA
  5. How do anthropoids differ from other primates?
  6. How do hominids differ from hominoids?

LAB 11.2: Phylum Cnidaria

Introduction: Animals are multicellular, heterotrophic, eukaryotic organisms. The cells of these organisms lack cell walls that are characteristics of other kingdoms of organisms.

The cnidaria are two-layered, radially symmetrical, aquatic animals. They are characterized by the presence of stinging cells (cnidocytes) that are used for protection and food gathering.

Purpose: To identify and study the characteristics of different representatives of the Phlyum Cnidaria.

Objectives:

  • Identify the characteristics of the organisms belonging to the Kingdom Animalia.
  • Identify the characteristics of the organisms belonging to the Phylum Cnidaria.
  • Identify the characteristics of the classes of the Phylum Cnidaria: Anthozoa, Hydrozoa, Cubozoa, Scyphozoa.
  • Identify and state the function of the following parts of genus Hydra (Class Hydrozoa): Tentacles, Body, Foot, Ectoderm, Mesoglea, Endoderm, Gastrovascular cavity, Cnidocytes (stinging cells), Testis, Ovary, Bud.
  • Identify and state the function of the following parts of the genus Obelia (Class Hydrozoa): Feeding polyp, Reproductive polyp, Medusa, Tentacles, Mouth, Gonads.

Slides:

Kingdom

Phylum

Class

#

Genus

Body Form

Description

Animalia

Cnidaria

Hydrozoa

17

Obelia

Medusa

Medusa

Animalia

Cnidaria

Hydrozoa

12-3 or 203

Obelia

Polyp

Polyp colony

Animalia

Cnidaria

Hydrozoa

18

Hydra

Polyp

Cross section

Animalia

Cnidaria

Hydrozoa

19A

Hydra

Polyp

Budding

Animalia

Cnidaria

Hydrozoa

19B

Hydra

Polyp

Spermaries

Animalia

Cnidaria

Hydrozoa

20

Hydra

Polyp

Ovary

Pre-Lab: The student should read the following pages in the course materials & study guide and the appropriate pages in the text and in the lab manual (see the Lab Syllabus). Provide a definition for each structure and explain the function of each of the vocabulary terms (in bold text) in the objectives list above. Make sure to note in which specimen the structure is found. Indicate in which part of the life cycle the structure is found.

In-Class Activities (Use your laboratory notebook to make drawings and answer questions):

  1. Look at each of the slides under the microscope. Draw the visible structures and label the visible parts.
  2. Look at each of the provided models. Draw the visible structures and label the parts.
  3. Look at each of the live specimens, making wet mount slides as needed. Draw the visible structures and label the parts.

Study Suggestions:

  1. What is the adaptive value of each of the two body forms, the polyp and the medusa, that are found in the Phylum Cnidaria?
  2. Which body form is Hydra an example of? Draw it. (Which slides show this body form?)
  3. Which body form is a jellyfish an example of? Draw it. (Which slide shows a different example of this body form?)
  4. What cells are unique to phylum Cnidaria (they are found in no other organisms)?
  5. What is a hydroskeleton? What purpose does it serve in Cnidarians?
  6. Give an example of a symbiosis involving a cnidarian.
  7. What is radial symmetry?

Optional Study Questions – Introduction to Animals

  1. Look at phylogeny on animal groups based on molecular evidence (DNA), found in chapter 18 of your textbook. Sponges (Phylum Porifera) do not have a solid line because they are not thought to be monophyletic (describes a group descended from a single ancestral species that gave rise to no species in any other group, Campbell 6th ed.).
    1. From which of the following groups are all animals descended?
      1. Bacteria ii) Protista iii) Fungi iv) Plantae
    2. Humans are in the Phylum Chordata. Which phylum shared a common ancestor with chordates most recently?
      1. Porifera (sponges) iii) Echinodermata v) Mollusca
      2. Cnidaria iv) Platyhelminthes (flatworms) vi) Arthropoda
    3. Which phylum has the most recent common ancestor with the bilaterians?
      1. Porifera (sponges) iii) Echinodermata v) Mollusca
      2. Cnidaria iv) Platyhelminthes (flatworms) vi) Arthropoda

LAB 12.1: Phylum Platyhelminthese

Introduction: The platyhelminthes are triploblastic, bi-laterally symmetrical animals with definite anterior and posterior ends. One group of flatworms, the Turbellaria, is non-parasitic and free-swimming. The other two flatworm groups are parasitic, having complex life cycles, usually involving more than one host. The flukes (Trematoda) have a flat, broad, leaf-like body. The tapeworms (Cestoda) are found in the digestive tracts of vertebrate animals.

Purpose: To identify and study the characteristics of representatives of the Phlyum Platyhelminthes, the flatworms.

Objectives Checklist:

  • Identify the characteristics of the organisms belonging to the Phylum Platyhelminthes.
  • Identify the characteristics of the classes of this phylum: Cestoda, Trematoda, Turbellaria.
  • Identify and state the function of the following parts of the genus Planaria (Class Turbellaria): head, eyespots, auricles, pharynx, mouth, gastrovascular cavity.
  • Identify and state the function of the following parts of the genus Fasciola (Class Trematoda): mouth, oral sucker, pharynx, ventral sucker, ovary (with eggs), testis.
  • Identify and state the function of the following parts of the genus Taenia (Class Cestoda): scolex, hooks, suckers, proglottids, ovary, testis.

Slides:

Kingdom

Phylum

Class

#

Genus (& species)

Description

Animalia

Platyhelminthes

Cestoda

21

Taenia pisiformis

Scolex - tapeworm

Animalia

Platyhelminthes

Trematoda

22

Fasciola hepatica

Sheep liver fluke

Animalia

Platyhelminthes

Turbellaria

23

Planaria

Free-living flatworm

Animalia

Platyhelminthes

Trematoda

24

Redia, cercariae

Animalia

Platyhelminthes

Trematoda

25

Clonorchis sinensis

Oriental liver fluke

Pre-Lab: The student should read the following pages in the course materials & study guide and the appropriate pages in the text and in the lab manual (see the Lab Syllabus). Provide a definition for each structure and explain the function of each of the vocabulary terms (in bold text) in the objectives list above. Make sure to note in which specimen the structure is found. Indicate in which part of the life cycle the structure is found.

In-Class Activities (Use your laboratory notebook to make drawings and answer questions):

  1. Look at each of the slides under the microscope. Draw the visible structures and label the visible parts.
  2. Look at each of the provided models. Draw the visible structures and label the parts.
  3. Look at each of the live specimens, making wet mount slides as needed. Draw the visible structures and label the parts.
  4. For each of the structures, indicate whether the structure is an adaptation for a free-living life history strategy or a parasitic life history strategy.

Study Suggestions:

  1. The construction of a dam and irrigation canals within a tropical agriculture community has increased crop production and increase the incidence of schistosomiasis, a blood fluke disease. Suggest three different ways to prevent people from becoming infected with the disease. Base these preventative methods on your knowledge of the life cycle of Schistosoma.
  2. What is a parasite?
  3. Explain how parasitism is a type of symbiosis.
  4. Explain why the tapeworm has such a rudimentary digestive system, but a huge reproductive system.
  5. What new adaptations are present in the flatworms that the cnidarians did not have?

LAB 12.2: Phylum Mollusca

Introduction: The molluscs are a large and diverse group of animals. All members of this group have a muscular foot and a mantle which secretes a shell. They possess a true coelom and a true circulatory system.

Purpose: To identify and study the characteristics of representatives of the Phylum Mollusca.

Objectives Checklist:

  • Identify the characteristics of the organisms belonging to the Phylum Mollusca
  • Identify the characteristics of the following classes of this phylum: Bivalvia, Gastropoda, Cephalopoda.
  • Identify and state the function of the following parts of Clam (Class Bivalvia): shells, adductor muscles, incurrent siphon, excurrent siphon, foot, gills, mantle, mouth, labial palps, heart, anus
  • Identify and state the function of the following parts of the genus Loligo (Class Cephalopoda): mantle, tentacles, arms, suckers, eyes, fin, mouth, radula, beak, pen, ink sac, gills, heart, stomach

Pre-Lab: The student should read the following pages in the course materials & study guide and the appropriate pages in the text and in the lab manual (see the Lab Syllabus). Provide a definition for each structure and explain the function of each of the vocabulary terms (in bold text) in the objectives list above. Make sure to note in which specimen the structure is found.

In-Class Activities (Use your laboratory notebook to make drawings and answer questions):

  1. Look at each of the provided models. Draw the visible structures and label the parts.
  2. Look at each of the specimens, making wet mount slides as needed. Draw the visible structures and label the parts.

Study Suggestions:

  1. Draw & label diagrams of the clam & the squid.
  2. List the characteristics of the phylum Mollusca. What are the major classes in Mollusca?
  3. The molluscs are economically important organisms. Explain three ways in which the molluscs can contribute to or take away from the economic development of a region.
  4. How is the body plan of a squid suited to the way it lives its life (its feeding strategy, etc.)?
  5. How is the body plan of a clam suited to the way it lives its life (its feeding strategy, habitat, etc.)?

LAB 13.1: Phylum Annelida

Introduction: The annelids exhibit segmentation, that is, the division of the body into repeated parts. This segmentation gives the organism greater flexibility and movement. In the earthworm, the external segmentation is characterized by the appearance of rings. Internally, the excretory and nervous systems are also segmented.

Purpose: To identify and study the characteristics of representatives of the Phylum Annelida.

Objectives Checklist:

  • Identify the characteristics of the organisms belonging to the Phylum Annelida.
  • Identify the characteristics of the following classes of this phylum: Oligochaeta, Polychaeta, Hirudinea.
  • Identify and state the function of the following external parts of the genus Lumbricus (Class Oligochaeta): mouth, segments, excretory pores, setae, clitellum, seminal groove, anus.
  • Identify and state the function of the following internal parts the genus Lumbricus (Class Oligochaeta): mouth, pharynx, esophagus, crop, gizzard, intestine, brain, ventral nerve cord, hearts, dorsal and ventral blood vessels, nephridium, seminal receptacles, seminal vesicle, coelom, typhlosole, lumen of intestine.

Slides:

Kingdom

Phylum

Class

#

Genus

Description

Animalia

Annelida

Oligochaeta

26

Lumbricus

Earthworm intestine, cross section

Pre-Lab: The student should read the following pages in the course materials & study guide and the appropriate pages in the text and in the lab manual (see the Lab Syllabus). Provide a definition for each structure and explain the function of each of the vocabulary terms (in bold text) in the objectives list above.

In-Class Activities (Use your laboratory notebook to make drawings and answer questions):

  1. Look at each of the slides under the microscope. Draw the visible structures and label the visible parts.
  2. Look at each of the provided models. Draw the visible structures and label the parts.

Study Suggestions:

  1. Draw & label a diagram of the earthworm.
  2. State the characteristics of the phylum Annelida. What are the major classes in Annelida?
  3. Contrast hermaphroditism in a tapeworm with that of an earthworm.
  4. What role do earthworms have in an ecosystem?

LAB 13.2: Phylum Arthropoda

Introduction: The arthropods are the most numerous and diverse of all the animals on Earth, living in every ecosystem. Their segmented bodies are characterized by jointed appendages that are adapted for motion, food gathering, defense and mating. They possess a chitinous exoskeleton that is shed periodically by molting and is replaced by a larger one that allows for the animal’s growth.

The crustaceans are arthropods that have a calcified exoskeleton. They are a major economic food group that includes lobster, crayfish, shrimp and crabs.

It is estimated that the total number of insect species exceeds the total number of all other animal species combined. One million species of insects have been identified and the estimate on the number of unidentified species is over two million. Insects are characterized by a three-part body, three pairs of legs, complex mouth parts adapted to particular ways of eating, and wings. Their life cycle exhibits a growth pattern known as metamorphosis. Insects such as the monarch butterfly have complete metamorphosis in which they go through four distinct stages: egg, larva (caterpillar), pupa (cocoon), and adult.

Purpose: To identify and study the characteristics of representatives of the Phlyum Arthropoda, classes Crustacea and Insecta.

Objectives Checklist:

  • Identify the characteristics of organisms belonging to the Phylum Arthropoda.
  • Identify the characteristics of the following classes of the Phylum Arthropoda: Insecta, Crustacea, Chelicerata, Chilopoda, Diplopoda.
  • Identify and state the function of the following external parts of the genus Cambarus (Class Crustacea): cheliped, antenna, antennules, eye, carapace, cephalothorax, abdomen, telson, uropod, swimmerets, walking legs, anus, opening of sperm duct, excretory pore, gills, distinction between male & female.
  • Identify and state the function of the following internal parts of the genus Cambarus (Class Crustacea): mouth, esophagus, gastric mill (stomach), intestine, green gland, heart, digestive gland, brain, ventral nerve cord.
  • Identify and state the function of the following external parts of the genus Romalea (Class Insecta): head, antenna, compound eye, mouth, thorax, wings, walking legs, jumping legs, tympanum, spiracles, abdomen, ovipositor (female), distinction between male and female.
  • Identify and state the function of the following internal parts of the genus Romalea (Class Insecta): mouth, esophagus, crop, stomach, intestine, gonad, dorsal blood vessel, gastric caeca (digestive gland), malpighian tubules, ventral nerve cord.

Pre-Lab: The student should read the following pages in the course materials & study guide and the appropriate pages in the text and in the lab manual (see the Lab Syllabus). Provide a definition for each structure and explain the function of each of the vocabulary terms (in bold text) in the objectives list above. Make sure to note in which specimen the structure is found. Indicate whether the structure is a jointed appendage.

In-Class Activities (Use your laboratory notebook to make drawings and answer questions):

  1. Look at each of the provided models. Draw the visible structures and label the parts.
  2. Look at each of the specimens. Draw the visible structures and label the parts.
  3. For each of the structures, indicate whether the structure is a jointed appendage, a segment, or a series of segments.

Study Suggestions:

  1. List the characteristics of the phylum Arthropoda. What are the major classes in Arthropoda?
  2. You are given a dead (but attractive) animal that you are told is an arthropod. What FOUR questions would you ask (and answer) yourself to determine which CLASS of Arthropoda your new acquisition belongs to?
  3. Draw & label a diagram of a crayfish.
  4. State the characteristics of the class Crustacea.
  5. Draw & label a diagram of a grasshopper.
  6. State the characteristics of the class Insecta.
  7. One of the key characteristics of arthropods is their jointed appendages. Describe FOUR DIFFERENT functions of these appendages, in FOUR DIFFERENT arthropods.

LAB 14.1: Deuterostomes, including Phylum Chordata

Introduction: The chordates are characterized by the presence of a dorsal hollow nerve chord, a notochord, gill structures, and a post-anal tail during the life span of the organism. This phylum encompasses the most recognizable of the animals: fish, amphibians, reptiles, birds, and mammals, including humans.

Purpose: To identify and study the characteristics of representatives of the Phylum Chordata.

Objectives Checklist:

  • Define deuterostome and distinguish it from protostome. Explain which animal phyla consist of deuterostomes.
  • Identify the characteristics of organisms belonging to the Phylum Echinodermata.
  • Identify the characteristics of organisms belonging to the Phylum Chordata.
  • Identify the characteristics of organisms belonging to the subphyla of the Phylum Chordata; the subphyla are Urochordata, Cephalochordata, and Vertebrata.
  • Identify the characteristics of the classes of the Subphylum Vertebrata: Agnatha, Chondrichthyes, Osteichthyes (Lobe-finned and Ray-finned fishes), Amphibia, Reptilia, Mammalia. Identify the characteristics of subclass Aves within class Reptilia.
  • Identify and state the function of the following external parts of the genus Rana (Class Amphibia): eyes, nares, eardrum (tympanum), tongue, anus, distinction between male & female.
  • Identify and state the function of the following internal parts of the genus Rana (Class Amphibia): teeth, heart, lungs, stomach, pancreas, spleen, liver, gallbladder, small intestine, large intestine, gonads, urinary bladder, cloaca, anus.

Pre-Lab: The student should read the following pages in the course materials & study guide and the appropriate pages in the text and in the lab manual (see the Lab Syllabus). Provide a definition for each structure and explain the function of each of the vocabulary terms (in bold text) in the objectives list above.

In-Class Activities (Use your laboratory notebook to make drawings and answer questions):

  1. Look at each of the provided models. Draw the visible structures and label the parts.
  2. Look at each of the specimens, making wet mount slides as needed. Draw the visible structures and label the parts.

Study Suggestions:

  1. Draw & label a diagram of a frog.
  2. State the characteristics of the phylum Chordata. Name the subphyla within phylum Chordata.
  3. State the characteristics of subphylum Vertebrata.
  4. Draw a phylogeny of the animal groups that you studied in labs 22 through 27.
  5. Using the Critical Thinking Method, answer the following question:

You are exploring a swamp and discover an animal unknown to you. It is bilaterally symmetrical, segmented, has a coelom and a complete digestive system. You try to determine the phylum to which it belongs. Which of the following choices correctly pairs one of the characteristics of a phylum with a phylum it rules out?

a) Complete digestive system rules out Annelida.

b) Coelom rules out Platyhelminthes

c) Segmentation rules out Chordata

d) Bilateral symmetry rules out Mollusca.

e) Anus opening at the tip of the tail rules out Arthropoda.

List the classes within the subphylum Vertebrata, their characteristics, and their key derived adaptations. You may want to include any major subclasses. Use a table like this one.

Class

Example organisms

Characteristics

Key derived adaptation(s)

LAB 14.2: Exam 4

Your last exam will take place during the final class meeting.

APPENDIX I: Biology 12 Slides

Old Slide #

New slide #

Slide Topic

12-1

201

Plasmodium falciparum

12-2

202

Trypanosoma gambiense

12-3

203

Obelia hydroid colony

12-4

204

Euglena

12-5

205

Testis Human

12-6

206

Ovary human

12-7

207

Chick Development 18hrs.

12-8

208

Chick Development 18 hrs. Serial

12-9

209

Chick Development 24hrs.

12-10

210

Chick Development 24hrs. Serial

12-11

211

Chick Development 33hrs.

12-12

212

Chick Development 33hrs. Serial

12-13

213

Chick Development 48hrs.

12-14

214

Chick Development 48hrs. Serial

12-15

215

Chick Development 72hrs.

12-16

216

Chick Development 72hrs. Serial

12-17

217

Chick Development 96hrs.

12-18

218

Chick Development 96hrs. Serial

12-19

219

Hydra Budding

12-20

220

Follicle Cat Sec. Mal

12-27

221

Oedogonium

12-22

222

Drosophila Salivary Gland Chromosomes

APPENDIX II: Biology 11 & 12 Slides

  1. Simple Squamous Epithelium
  2. Simple Columnar Epithelium
  3. Stratified Squamous Epithelium

4A. Skeletal Muscle

4B. Smooth Muscle

4C. Cardiac Muscle

  1. Hyaline Cartilage
  2. Bone (ground)
  3. Frog Blood
  4. Spinal Cord
  5. Frog - uncleaved egg
  6. Frog – early cleavage
  7. Frog – blastula
  8. Frog – gastrula
  9. Frog – neural fold
  10. Frog – neural tube
  11. Paramecium – conjugation
  12. Amoeba proteus
  13. Obelia – Medusa
  14. Hydra – c.s.

19A.Hydra budding

19B.Hydra spermaries

  1. Hydra Ovary
  2. Taenia pisiformis – scolex
  3. Fasciola hepatica
  4. Planaria
  5. Redia, cercariae – Flukes
  6. Clonorchis sinensis
  7. Earthworm intestine – c.s.
  8. Starfish Arm
  9. Starfish Egg – early & late cleavage
  10. Starfish Egg – blastula
  11. Starfish egg – gastrula
  12. Whitefish Mitosis
  13. Drosophila Chromosomes
  14. Gleocapsa
  15. Nostoc sec.
  16. Oscillatoria
  17. Desmids
  18. Oedogonium
  19. Root Hair
  20. Spirogyra (conjugation)
  21. Ulothrix
  22. Volvox
  23. Spirogyra comb.
  24. Diatoms
  25. Fucus dioecious comb.
  26. Fucus monoecious
  27. Polysiphonia (Red Algae)
  28. Bacteria comb.
  29. Mono-Dicot leaf

49. Rhizopus sporangia

50. Rhizopus conjugation

51. Mono–Dicot Root

52. Penicillium Aspergillus comb

53. Peziza

54. Caviceps purpura

55. Ligustrum leaf

56. Coprinus

57. Allium Root Tip

58. Sambucus Stem (flowering plant – elderberry)

59. Physica Lichen (Thallus)

60. Marchantia (Cupule)

61. Marchantia (Antheridia)

62. Marchantia (Archegonia)

63. Marchantia (Sporophyte)

64. Polytrichum Moss Antheridia & Paraphysis

65. Polytrichum Moss (Capsule)

66. Sphagnum proteonema

67. Fern prothallia

68. Fern Embryo (Sporophyte)

69. Polypodium (Leaflet)

70. Polypodium (Rhizome)

71. Selaginella Strobilus l.s.

72. Mono-Dicot Stem

73. Elodea Stem Tip

74. Pine Stem (several years)

75. Pine 5 Needle

76. Pine Staminate Cone

77. Pine Female Cone

78. Pine Mature Pollen

79. Zamia Archegonia (Ovule)

80. Vicia Faba Root Tip Squash

81. Tilia Stem

82. Ranunculus Root

83. Sedum Leaf Epidermis (c)

84. Lateral Root Origin (s)

85. Flower Bud

86. Lilium Anther – Late Prophase

87. Lilium Anther - Tetrad

88. Lilium Anther – Mature Pollen

89. Pollen Tubes

90. Capsella Late Embryo

91. Capsella Mature

92. Zea Mays Embryo

93. Olfactory Epithelium

94. Adipose Tissue

95. Areolar Tissue

96. Blood Smear (Human)

97. Letter “e”

98. Silk Fiber Thread

APPENDIX III: Laboratory Rules and Academic Responsibility

Laboratory Safety: Lab safety is everyone’s responsibility.

  1. Be familiar with the exercises and experiments that you will be doing before coming to laboratory. This will increase your understanding, enjoyment, and safety during the laboratory.
  2. Know your own allergies and be aware of the potential allergens (e.g. Penicillin, pollen, latex, peanuts) that might be present in the laboratory.  Take the necessary precautions to prevent allergic reactions.
  3. Know where the shower, eyewash bath, and fire extinguisher are and how and when to use them.
  4. Know what to do if you are injured during class.
  5. Do not put backpacks, bags, or other personal items on the lab bench. Keep them out of the way under the bench.
  6. Follow all protocols (instructions for experiments procedures) carefully. Varying the order could be dangerous.
  7. Approach all chemicals with caution. Do not taste or inhale (smell) chemicals. Avoid getting chemicals on your skin. We may use strong acids and bases that can cause chemical burns. We may use chemicals that have been linked to causing cancer (carcinogens).
  8. Wash your hands before and after each laboratory session. Good hygiene is important in limiting the spread of disease. Hand-washing will also get rid of any chemical residues you might have inadvertently been exposed to.
  9. No food or drink in the laboratory, including water. If you are thirsty or hungry, leave the classroom.
  10. Smoking is prohibited in all public buildings in New York City, including this one.
  11. Report accidents and breakages or any equipment that is malfunctioning to your professor. Do not attempt to clean up any spills or breakages yourself. Tell your professor.
  12. Long hair and flowing clothing can be dangerous in the laboratory because they can get caught. Open-toed shoes or sandals are not to be worn in the lab because chemicals might spill directly on your skin. You may bring an old shirt to class to wear over you clothing.
  13. Do not wear contact lenses in the lab. Lenses may absorb fumes and cause permanent damage.
  14. Never remove chemicals, equipment, or parts of models from the laboratory. Anyone caught doing so is subject to disciplinary action.
  15. Leave the lab in the same or better condition than when you entered. Put all microscopes back properly. Clean lab benches. Return all materials to the cart. Wash any glassware, slides, trays that you have used. Dispose of specimens in appropriate containers.

Academic Responsibility:

  1. You are responsible for all material in both the laboratory and lecture syllabi, regardless of whether the material was covered during a lab or lecture session.
  2. You are responsible for reading the required parts of the text, laboratory manual, course study guide, and any supplemental material provided by your professor.
  3. You are responsible for keeping track of any changes in the syllabus. Announcements may be made in class, through your BCC email, and/or on Blackboard.
  4. If you miss a lab or lecture, you are responsible for the material you missed. Ask your classmates to lend you their notes.
  5. You are responsible for your learning. You are responsible for studying, memorizing, and applying the facts and concepts in the lab manual, the text, and the syllabus, not your professor.

Annotate

Powered by Manifold Scholarship. Learn more at
Opens in new tab or windowmanifoldapp.org